Incidental Mutation 'R0743:Plrg1'
List |< first << previous [record 35 of 58] next >> last >|
ID70760
Institutional Source Beutler Lab
Gene Symbol Plrg1
Ensembl Gene ENSMUSG00000027998
Gene Namepleiotropic regulator 1
SynonymsTango4
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83055522-83072355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83059917 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 132 (S132P)
Ref Sequence ENSEMBL: ENSMUSP00000114968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029628] [ENSMUST00000122128] [ENSMUST00000150268]
Predicted Effect probably benign
Transcript: ENSMUST00000029628
AA Change: S132P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029628
Gene: ENSMUSG00000027998
AA Change: S132P

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122128
AA Change: S123P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113614
Gene: ENSMUSG00000027998
AA Change: S123P

DomainStartEndE-ValueType
WD40 183 222 1.92e-10 SMART
WD40 225 264 1.68e-6 SMART
WD40 267 306 1.96e-7 SMART
WD40 309 348 5.95e-7 SMART
WD40 351 389 1.12e-2 SMART
WD40 392 430 5.47e-6 SMART
WD40 442 480 5.97e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150268
AA Change: S132P

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114968
Gene: ENSMUSG00000027998
AA Change: S132P

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
WD40 360 398 1.12e-2 SMART
WD40 401 439 5.47e-6 SMART
WD40 451 489 5.97e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Plrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Plrg1 APN 3 83070673 missense probably damaging 0.99
IGL00824:Plrg1 APN 3 83068335 missense probably damaging 1.00
IGL00948:Plrg1 APN 3 83068119 missense probably damaging 1.00
IGL02550:Plrg1 APN 3 83061123 critical splice donor site probably null
R1624:Plrg1 UTSW 3 83067994 splice site probably benign
R1624:Plrg1 UTSW 3 83069744 missense probably damaging 1.00
R1630:Plrg1 UTSW 3 83058763 missense probably benign 0.00
R1876:Plrg1 UTSW 3 83069068 splice site probably benign
R2383:Plrg1 UTSW 3 83065948 missense probably damaging 1.00
R2892:Plrg1 UTSW 3 83071240 missense probably damaging 1.00
R3406:Plrg1 UTSW 3 83071219 missense probably damaging 1.00
R5114:Plrg1 UTSW 3 83071251 missense probably benign 0.13
R5922:Plrg1 UTSW 3 83056848 missense possibly damaging 0.77
R6333:Plrg1 UTSW 3 83056795 missense probably damaging 1.00
R7127:Plrg1 UTSW 3 83059915 missense probably damaging 1.00
R7530:Plrg1 UTSW 3 83058682 missense probably damaging 1.00
R7814:Plrg1 UTSW 3 83056837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGCGTTCTCTTAATACCAAGCTGC -3'
(R):5'- GCTGAAATGGTACAGTGTGGGCA -3'

Sequencing Primer
(F):5'- ATACCAAGCTGCTTGTGTTCAG -3'
(R):5'- CTGGATTCCACATTTTACGTGT -3'
Posted On2013-09-30