Incidental Mutation 'R9342:Xpnpep1'
ID 707607
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52993248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 360 (I360F)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: I360F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: I360F

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: I360F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: I360F

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik T C 5: 130,407,876 (GRCm39) I112V unknown Het
Aars2 A G 17: 45,818,002 (GRCm39) N75D possibly damaging Het
Abcf2 G A 5: 24,778,475 (GRCm39) R228C probably benign Het
Agfg2 A G 5: 137,652,114 (GRCm39) L415P probably benign Het
Alpi A G 1: 87,026,386 (GRCm39) L535P unknown Het
Anxa9 T G 3: 95,210,359 (GRCm39) T69P probably damaging Het
Arrb2 T A 11: 70,327,463 (GRCm39) D79E probably benign Het
Bcat1 A G 6: 144,994,332 (GRCm39) V55A probably benign Het
Cacna1c A G 6: 119,034,335 (GRCm39) L64P Het
Cd247 A T 1: 165,682,759 (GRCm39) D28V probably damaging Het
Celsr2 T A 3: 108,320,442 (GRCm39) N790I probably damaging Het
Clrn1 C T 3: 58,792,251 (GRCm39) V71I probably benign Het
Cmtr2 T C 8: 110,949,078 (GRCm39) Y463H possibly damaging Het
Col6a6 T C 9: 105,663,172 (GRCm39) T122A probably benign Het
Cubn T A 2: 13,463,767 (GRCm39) D646V probably damaging Het
Dab2ip T A 2: 35,613,105 (GRCm39) L1062Q possibly damaging Het
Dnajb4 T C 3: 151,892,272 (GRCm39) N187S probably benign Het
Dock10 A T 1: 80,570,360 (GRCm39) F365L probably benign Het
Erich6 G A 3: 58,534,101 (GRCm39) Q309* probably null Het
Ext1 T C 15: 53,208,524 (GRCm39) H79R probably benign Het
Fam187b T A 7: 30,677,185 (GRCm39) C231* probably null Het
Fbh1 T C 2: 11,754,414 (GRCm39) I775V probably benign Het
Fbxo15 T A 18: 84,983,609 (GRCm39) M319K unknown Het
Fbxo9 A T 9: 78,002,520 (GRCm39) M187K possibly damaging Het
Fer1l4 T C 2: 155,877,196 (GRCm39) D1113G probably benign Het
Fsip2 A T 2: 82,818,747 (GRCm39) T4827S possibly damaging Het
Gm49398 A T 13: 61,435,478 (GRCm39) L7Q probably damaging Het
H2-M10.4 A T 17: 36,771,285 (GRCm39) W298R probably damaging Het
Hoxd10 A G 2: 74,522,982 (GRCm39) E220G probably benign Het
Hrh2 T G 13: 54,368,222 (GRCm39) L66R probably damaging Het
Igf1r A G 7: 67,844,746 (GRCm39) T840A probably benign Het
Iqca1 A G 1: 90,072,688 (GRCm39) V64A probably damaging Het
Klc2 A G 19: 5,158,659 (GRCm39) S612P probably benign Het
Klf15 A G 6: 90,443,851 (GRCm39) E142G probably damaging Het
Krt40 T A 11: 99,429,579 (GRCm39) T332S probably damaging Het
Lrrc9 T C 12: 72,506,767 (GRCm39) F348S probably damaging Het
Lrrn4 T C 2: 132,712,290 (GRCm39) D511G probably benign Het
Lrtm2 T C 6: 119,297,934 (GRCm39) I36V probably benign Het
Lsm10 T C 4: 125,991,860 (GRCm39) L72P probably damaging Het
Mab21l3 T A 3: 101,742,519 (GRCm39) S14C possibly damaging Het
Map2k4 T C 11: 65,581,569 (GRCm39) K381R probably benign Het
Mcidas A G 13: 113,130,915 (GRCm39) D80G probably damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mga A G 2: 119,778,656 (GRCm39) D2067G probably benign Het
Ms4a19 T A 19: 11,119,775 (GRCm39) T52S possibly damaging Het
Msc G T 1: 14,825,707 (GRCm39) P89Q probably benign Het
Nalf1 C A 8: 9,821,006 (GRCm39) A5S probably damaging Het
Or14c44 A G 7: 86,062,430 (GRCm39) I287V probably benign Het
Or2d3c A T 7: 106,526,564 (GRCm39) I34N possibly damaging Het
Or5t7 A T 2: 86,507,494 (GRCm39) L61Q probably damaging Het
Plekhg6 T C 6: 125,340,023 (GRCm39) D779G probably damaging Het
Pnpla2 C A 7: 141,035,331 (GRCm39) Y44* probably null Het
Ppp1r17 T A 6: 56,003,524 (GRCm39) D112E probably damaging Het
Prdm2 A G 4: 142,861,478 (GRCm39) I604T probably damaging Het
Prkce A G 17: 86,781,877 (GRCm39) Y182C probably damaging Het
Prokr2 G A 2: 132,182,790 (GRCm39) S189F possibly damaging Het
Qser1 A T 2: 104,618,164 (GRCm39) S793T probably benign Het
Reck T C 4: 43,943,301 (GRCm39) F951S probably benign Het
Rev3l T C 10: 39,697,458 (GRCm39) S652P probably benign Het
Rtl1 A C 12: 109,558,884 (GRCm39) L985R probably damaging Het
Sardh T C 2: 27,120,869 (GRCm39) E385G possibly damaging Het
Sfmbt1 G T 14: 30,519,599 (GRCm39) W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 (GRCm38) C683* probably null Het
Slc51a A G 16: 32,298,517 (GRCm39) L80P possibly damaging Het
Slco3a1 C A 7: 74,154,037 (GRCm39) L178F probably damaging Het
Spata6 T A 4: 111,636,389 (GRCm39) C227S possibly damaging Het
Tbc1d30 A T 10: 121,103,366 (GRCm39) Y555* probably null Het
Tcf7l2 A G 19: 55,731,517 (GRCm39) Q90R probably benign Het
Tff3 A C 17: 31,346,423 (GRCm39) S50A probably benign Het
Tnrc6c T C 11: 117,630,720 (GRCm39) M1027T probably benign Het
Ttc12 A G 9: 49,351,680 (GRCm39) F606L probably benign Het
Uqcc3 G A 19: 8,858,090 (GRCm39) Q34* probably null Het
Veph1 T A 3: 66,151,959 (GRCm39) I157F probably damaging Het
Vmn2r14 G A 5: 109,368,428 (GRCm39) T188I probably damaging Het
Vmn2r67 A G 7: 84,785,788 (GRCm39) I739T probably benign Het
Vmn2r68 A G 7: 84,882,993 (GRCm39) F253S probably benign Het
Vmn2r74 T C 7: 85,606,624 (GRCm39) I241V probably benign Het
Vmn2r97 A G 17: 19,149,368 (GRCm39) E252G probably benign Het
Vps13b T C 15: 35,455,200 (GRCm39) V703A possibly damaging Het
Vps25 T A 11: 101,149,623 (GRCm39) L149Q probably damaging Het
Xirp1 T C 9: 119,845,950 (GRCm39) T978A probably benign Het
Zfpm1 C T 8: 123,061,308 (GRCm39) T291M probably benign Het
Zkscan8 A G 13: 21,710,702 (GRCm39) V136A probably benign Het
Zscan18 A G 7: 12,505,612 (GRCm39) Y592H probably damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACAATCATTTCATGCTCCCACTGAC -3'
(R):5'- TCAAAGAGCGCGGCTTAGAG -3'

Sequencing Primer
(F):5'- CTGACTCTGGAAAACCTGAGGAC -3'
(R):5'- TGAACTCACGCTGTGCTGAAC -3'
Posted On 2022-04-18