Incidental Mutation 'R9343:Col9a2'
ID 707617
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9343 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120911483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 608 (M608K)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030372
AA Change: M608K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: M608K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat2 T C 17: 13,167,538 (GRCm39) N166S probably damaging Het
Atp8b2 A T 3: 89,855,811 (GRCm39) F446I possibly damaging Het
Cacna2d3 A T 14: 28,704,315 (GRCm39) M822K possibly damaging Het
Caskin1 A G 17: 24,723,447 (GRCm39) E745G probably damaging Het
Clec4a2 G T 6: 123,104,955 (GRCm39) A82S probably benign Het
Col5a3 T C 9: 20,704,909 (GRCm39) N749S unknown Het
Cope T C 8: 70,761,228 (GRCm39) probably null Het
Dennd2d T A 3: 106,397,730 (GRCm39) probably null Het
Dpys T C 15: 39,656,748 (GRCm39) T440A possibly damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln5 G A 12: 101,737,551 (GRCm39) T152I probably damaging Het
Gm16503 A T 4: 147,625,508 (GRCm39) M1L unknown Het
Gm9195 A G 14: 72,717,500 (GRCm39) S278P probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Klhl33 A G 14: 51,133,903 (GRCm39) probably null Het
Lrrk2 A G 15: 91,584,618 (GRCm39) D345G probably benign Het
Man2b2 A G 5: 36,975,951 (GRCm39) L368P probably damaging Het
Med23 T A 10: 24,788,705 (GRCm39) S1371T probably benign Het
Mllt3 T A 4: 87,792,168 (GRCm39) E109D possibly damaging Het
Myom2 G A 8: 15,134,633 (GRCm39) D479N probably damaging Het
Or52r1c A T 7: 102,735,324 (GRCm39) R195* probably null Het
Pcdhga10 G T 18: 37,880,532 (GRCm39) A98S probably benign Het
Pde8a A T 7: 80,950,427 (GRCm39) Q221H probably benign Het
Pkd1l1 T C 11: 8,786,399 (GRCm39) H2335R Het
Pkd1l1 T A 11: 8,911,305 (GRCm39) D324V Het
Pou2f2 G A 7: 24,794,277 (GRCm39) T363I possibly damaging Het
Prlr A G 15: 10,328,988 (GRCm39) I488V probably benign Het
Psmd2 T C 16: 20,475,441 (GRCm39) probably null Het
Rbm7 T C 9: 48,400,969 (GRCm39) D253G probably damaging Het
Ros1 A G 10: 51,972,116 (GRCm39) probably null Het
S1pr3 G T 13: 51,573,553 (GRCm39) V245L probably damaging Het
Sacs A G 14: 61,446,219 (GRCm39) D2755G probably benign Het
Scgn T A 13: 24,173,829 (GRCm39) probably null Het
Sh3rf3 A G 10: 58,966,802 (GRCm39) K715E probably damaging Het
Sox18 T C 2: 181,312,231 (GRCm39) E300G probably damaging Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Spef2 T A 15: 9,713,190 (GRCm39) N394I probably damaging Het
Strn4 T C 7: 16,573,827 (GRCm39) F759L probably damaging Het
Tas2r144 A T 6: 42,193,066 (GRCm39) I269F probably benign Het
Tpcn1 T C 5: 120,678,737 (GRCm39) D606G possibly damaging Het
Trh A G 6: 92,220,823 (GRCm39) I13T probably benign Het
Umodl1 T C 17: 31,217,701 (GRCm39) I1169T possibly damaging Het
Vwa3b G A 1: 37,153,615 (GRCm39) D486N probably damaging Het
Wars2 T C 3: 99,094,846 (GRCm39) L47P probably benign Het
Zbtb14 A G 17: 69,695,576 (GRCm39) S425G probably damaging Het
Zdhhc16 T C 19: 41,926,549 (GRCm39) S111P probably benign Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTCCCAAATCTTATCTGGATC -3'
(R):5'- TCAAGAGTCCCAACTGCCAG -3'

Sequencing Primer
(F):5'- ATCTGGATCTCCCTTTATCTAACCAG -3'
(R):5'- GTCCCAACTGCCAGCTCCC -3'
Posted On 2022-04-18