Incidental Mutation 'R0743:Synpo2'
ID70763
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Namesynaptopodin 2
Synonyms1110069I04Rik, Myo, 9530006G20Rik, 2310068J10Rik, myopodin
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123076519-123236149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123112706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 987 (V987A)
Ref Sequence ENSEMBL: ENSMUSP00000142508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
Predicted Effect probably benign
Transcript: ENSMUST00000051443
AA Change: V657A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315
AA Change: V657A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106426
AA Change: V987A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: V987A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106427
AA Change: V987A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: V987A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139160
AA Change: V35A
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315
AA Change: V35A

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
AA Change: V94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315
AA Change: V94A

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198584
AA Change: V987A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: V987A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 123113210 missense probably damaging 1.00
IGL00742:Synpo2 APN 3 123113876 missense probably damaging 1.00
IGL01890:Synpo2 APN 3 123112497 missense probably damaging 1.00
IGL02268:Synpo2 APN 3 123116983 missense probably damaging 1.00
IGL02323:Synpo2 APN 3 123117534 missense probably benign 0.00
IGL02745:Synpo2 APN 3 123113612 missense probably damaging 1.00
IGL03001:Synpo2 APN 3 123079955 missense probably benign 0.00
IGL03177:Synpo2 APN 3 123121215 missense probably damaging 1.00
IGL03336:Synpo2 APN 3 123114179 missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 123117104 nonsense probably null
R0126:Synpo2 UTSW 3 123079862 missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 123113793 missense probably benign 0.02
R0284:Synpo2 UTSW 3 123079734 nonsense probably null
R0388:Synpo2 UTSW 3 123079897 missense probably benign
R0457:Synpo2 UTSW 3 123112772 missense probably damaging 1.00
R0483:Synpo2 UTSW 3 123114332 missense probably damaging 1.00
R0615:Synpo2 UTSW 3 123117287 missense probably damaging 1.00
R0646:Synpo2 UTSW 3 123114449 missense probably damaging 1.00
R0666:Synpo2 UTSW 3 123114059 missense probably damaging 0.98
R0791:Synpo2 UTSW 3 123113186 missense probably benign
R1531:Synpo2 UTSW 3 123117666 missense probably benign 0.03
R1587:Synpo2 UTSW 3 123114398 missense probably damaging 0.98
R1717:Synpo2 UTSW 3 123112554 missense probably damaging 1.00
R1807:Synpo2 UTSW 3 123080257 missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 123079888 missense probably benign 0.01
R2987:Synpo2 UTSW 3 123116973 missense probably damaging 1.00
R3019:Synpo2 UTSW 3 123113579 missense probably damaging 1.00
R3939:Synpo2 UTSW 3 123114590 missense probably damaging 1.00
R4050:Synpo2 UTSW 3 123114278 missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 123117150 missense probably damaging 1.00
R4669:Synpo2 UTSW 3 123113063 missense probably damaging 1.00
R4724:Synpo2 UTSW 3 123114291 missense probably damaging 1.00
R4825:Synpo2 UTSW 3 123114419 missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123235901 critical splice donor site probably null
R5292:Synpo2 UTSW 3 123114060 missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 123117682 nonsense probably null
R5701:Synpo2 UTSW 3 123080230 missense probably damaging 1.00
R5712:Synpo2 UTSW 3 123121210 missense probably damaging 1.00
R5730:Synpo2 UTSW 3 123114119 missense probably benign 0.04
R5879:Synpo2 UTSW 3 123114297 missense probably damaging 1.00
R5979:Synpo2 UTSW 3 123117411 missense probably damaging 1.00
R6290:Synpo2 UTSW 3 123117052 missense probably damaging 0.98
R6384:Synpo2 UTSW 3 123113049 nonsense probably null
R6498:Synpo2 UTSW 3 123080232 synonymous probably null
R7123:Synpo2 UTSW 3 123113186 missense probably benign
R7153:Synpo2 UTSW 3 123112404 makesense probably null
R7233:Synpo2 UTSW 3 123117684 missense probably benign 0.01
R7301:Synpo2 UTSW 3 123114053 missense probably benign 0.10
R7318:Synpo2 UTSW 3 123117319 missense probably benign
R7366:Synpo2 UTSW 3 123114041 missense probably damaging 0.96
R7630:Synpo2 UTSW 3 123080032 missense probably damaging 1.00
R8068:Synpo2 UTSW 3 123117392 missense possibly damaging 0.59
Z1177:Synpo2 UTSW 3 123113010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCACACCTGAACTGTGACCC -3'
(R):5'- GCTGCTATCAAGTCTCAACCACCG -3'

Sequencing Primer
(F):5'- AGAACTTCGGCCTTGGAGC -3'
(R):5'- TCTCAACCACCGGGTGC -3'
Posted On2013-09-30