Mutagenetix > Incidental Mutation

Incidental Mutation 'R9343:Umodl1'

707652

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9343 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30998727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1169 (I1169T)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066554
AA Change: I1169T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: I1169T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: I1054T

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: I1054T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114555
AA Change: I1169T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: I1169T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat2	T	C	17: 12,948,651	N166S	probably damaging	Het
Atp8b2	A	T	3: 89,948,504	F446I	possibly damaging	Het
Cacna2d3	A	T	14: 28,982,358	M822K	possibly damaging	Het
Caskin1	A	G	17: 24,504,473	E745G	probably damaging	Het
Clec4a2	G	T	6: 123,127,996	A82S	probably benign	Het
Col5a3	T	C	9: 20,793,613	N749S	unknown	Het
Col9a2	T	A	4: 121,054,286	M608K	probably benign	Het
Cope	T	C	8: 70,308,578		probably null	Het
Dennd2d	T	A	3: 106,490,414		probably null	Het
Dpys	T	C	15: 39,793,352	T440A	possibly damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Fbln5	G	A	12: 101,771,292	T152I	probably damaging	Het
Gm16503	A	T	4: 147,541,051	M1L	unknown	Het
Gm9195	A	G	14: 72,480,060	S278P	probably damaging	Het
Hmcn2	A	G	2: 31,389,347	N1787S	probably benign	Het
Klhl33	A	G	14: 50,896,446		probably null	Het
Lrrk2	A	G	15: 91,700,415	D345G	probably benign	Het
Man2b2	A	G	5: 36,818,607	L368P	probably damaging	Het
Med23	T	A	10: 24,912,807	S1371T	probably benign	Het
Mllt3	T	A	4: 87,873,931	E109D	possibly damaging	Het
Myom2	G	A	8: 15,084,633	D479N	probably damaging	Het
Olfr584	A	T	7: 103,086,117	R195*	probably null	Het
Pcdhga10	G	T	18: 37,747,479	A98S	probably benign	Het
Pde8a	A	T	7: 81,300,679	Q221H	probably benign	Het
Pkd1l1	T	C	11: 8,836,399	H2335R		Het
Pkd1l1	T	A	11: 8,961,305	D324V		Het
Pou2f2	G	A	7: 25,094,852	T363I	possibly damaging	Het
Prlr	A	G	15: 10,328,902	I488V	probably benign	Het
Psmd2	T	C	16: 20,656,691		probably null	Het
Rbm7	T	C	9: 48,489,669	D253G	probably damaging	Het
Ros1	A	G	10: 52,096,020		probably null	Het
S1pr3	G	T	13: 51,419,517	V245L	probably damaging	Het
Sacs	A	G	14: 61,208,770	D2755G	probably benign	Het
Scgn	T	A	13: 23,989,846		probably null	Het
Sh3rf3	A	G	10: 59,130,980	K715E	probably damaging	Het
Sox18	T	C	2: 181,670,438	E300G	probably damaging	Het
Spef2	T	A	15: 9,713,104	N394I	probably damaging	Het
Strn4	T	C	7: 16,839,902	F759L	probably damaging	Het
Tas2r144	A	T	6: 42,216,132	I269F	probably benign	Het
Tpcn1	T	C	5: 120,540,672	D606G	possibly damaging	Het
Trh	A	G	6: 92,243,842	I13T	probably benign	Het
Vwa3b	G	A	1: 37,114,534	D486N	probably damaging	Het
Wars2	T	C	3: 99,187,530	L47P	probably benign	Het
Zbtb14	A	G	17: 69,388,581	S425G	probably damaging	Het
Zdhhc16	T	C	19: 41,938,110	S111P	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTCCTTAGAATCACCTTTGG -3'
(R):5'- CTCGACCACTCAGAGTTTGC -3'

Sequencing Primer
(F):5'- ACCTTTGGTGGGGAGGAAC -3'
(R):5'- CACTCAGAGTTTGCCTGGAGATAC -3'

Posted On

2022-04-18