Mutagenetix > Incidental Mutation

Incidental Mutation 'R9344:Sema4c'

707657

Institutional Source

Beutler Lab

Gene Symbol

Sema4c

Ensembl Gene

ENSMUSG00000026121

Gene Name

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C

Synonyms

Semaf, Semacl1, M-Sema F, Semacl1, Semai

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9344 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36548639-36558349 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36553314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 182 (N182D)

Ref Sequence

ENSEMBL: ENSMUSP00000110643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195339] [ENSMUST00000195620]

AlphaFold

Q64151

Predicted Effect

probably damaging
Transcript: ENSMUST00000114991
AA Change: N182D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: N182D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000191642
AA Change: N182D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: N182D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000191677
AA Change: N182D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: N182D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193382

Predicted Effect

probably benign
Transcript: ENSMUST00000195339

Predicted Effect

probably damaging
Transcript: ENSMUST00000195620
AA Change: N182D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: N182D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Sema	53	481	2.54e-183	SMART
PSI	499	552	4.52e-11	SMART
IG	563	647	1.77e-4	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	754	774	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	A	G	16: 64,770,772	V31A	possibly damaging	Het
Adss	A	G	1: 177,769,961	Y378H	probably damaging	Het
Aldh1a1	T	A	19: 20,630,786	V324D	probably damaging	Het
Ankrd33b	A	G	15: 31,297,757	S285P	probably damaging	Het
Arel1	C	T	12: 84,934,597	G269S	probably damaging	Het
Arhgap44	A	G	11: 65,162,637	M1T	probably null	Het
Arpin	C	T	7: 79,928,235	V149I	probably benign	Het
Arpp21	A	G	9: 112,185,652	L28P	possibly damaging	Het
Ccdc129	C	T	6: 55,978,485	T1026I	probably benign	Het
Ccr8	G	A	9: 120,094,067	V83I	probably damaging	Het
Cnksr1	T	C	4: 134,236,197	E58G	probably damaging	Het
Dctn2	T	A	10: 127,278,215	H341Q	probably damaging	Het
Ddx21	C	A	10: 62,593,046	A362S	possibly damaging	Het
Dnajc1	C	T	2: 18,284,775	V274I	probably benign	Het
Dock3	A	C	9: 106,993,564	C550W	probably damaging	Het
Dst	T	C	1: 34,181,595	L2160S	probably damaging	Het
Duox1	T	A	2: 122,337,682	M1096K	probably benign	Het
Dync2h1	A	T	9: 7,148,659	D928E	probably benign	Het
E030025P04Rik	C	T	11: 109,139,628		probably null	Het
Eid2b	T	C	7: 28,278,166	M129T	possibly damaging	Het
Fnip2	G	A	3: 79,500,410	S288F	possibly damaging	Het
Grm4	G	T	17: 27,434,763	R738S	probably benign	Het
Gsto2	A	G	19: 47,876,445	D139G	probably benign	Het
Herc2	T	A	7: 56,122,364	V1097E	probably benign	Het
Impg1	G	A	9: 80,404,758	A181V	probably benign	Het
Irs2	G	T	8: 11,007,289	S381*	probably null	Het
Lrrd1	A	C	5: 3,858,819	D697A	possibly damaging	Het
Nat10	A	G	2: 103,743,115	S346P	probably damaging	Het
Ncapg2	G	A	12: 116,424,653	R319H	probably damaging	Het
Nid1	A	G	13: 13,478,309	Y568C	probably damaging	Het
Noc2l	G	A	4: 156,240,673	C325Y	probably damaging	Het
Olfr1121	A	T	2: 87,371,817	D95V	possibly damaging	Het
Olfr23	C	A	11: 73,940,918	S224Y	possibly damaging	Het
Pde2a	G	T	7: 101,495,684	V169F	possibly damaging	Het
Pon3	T	C	6: 5,221,586	K348R	probably benign	Het
Ppp6c	A	G	2: 39,200,040		probably null	Het
Prrc2b	G	A	2: 32,213,588	G1026D	probably benign	Het
Psg22	A	T	7: 18,726,891	T482S	possibly damaging	Het
Rdh19	G	A	10: 127,856,871	V136M	probably damaging	Het
Sbf2	T	A	7: 110,341,328	N1275I	probably benign	Het
Slc7a12	T	A	3: 14,505,431	H414Q	probably damaging	Het
Slitrk5	A	G	14: 111,679,270	I109V	probably damaging	Het
Spag17	C	T	3: 100,103,477	P2096S	probably benign	Het
Steap1	T	A	5: 5,736,459	D326V	probably damaging	Het
Tacr1	C	T	6: 82,403,866	T86I	probably damaging	Het
Tenm4	C	T	7: 96,896,145	T2493I	probably damaging	Het
Tet2	A	G	3: 133,469,354	S1411P	possibly damaging	Het
Tom1	C	T	8: 75,058,448	R303C	probably damaging	Het
Trav7n-4	T	A	14: 53,091,743	I70N	possibly damaging	Het
Utrn	A	C	10: 12,684,531	V1338G	probably benign	Het
Vipr1	G	A	9: 121,642,927		probably null	Het
Vmn1r122	A	T	7: 21,133,346	H261Q	probably benign	Het
Vmn1r40	G	T	6: 89,714,253	L17F	probably benign	Het
Vmn2r54	A	G	7: 12,632,356	V217A	probably benign	Het
Vmn2r55	C	A	7: 12,651,855	G733*	probably null	Het
Vmn2r98	A	T	17: 19,066,515	N425I	probably benign	Het
Vps51	C	T	19: 6,076,315	V136I	unknown	Het
Zfp184	T	C	13: 21,960,241	C706R	probably damaging	Het

Other mutations in Sema4c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Sema4c	APN	1	36553920	critical splice donor site	probably benign	0.00
IGL01824:Sema4c	APN	1	36553029	missense	possibly damaging	0.76
IGL02236:Sema4c	APN	1	36553085	missense	probably damaging	1.00
IGL02262:Sema4c	APN	1	36550341	missense	probably damaging	1.00
IGL02282:Sema4c	APN	1	36550203	splice site	probably null
IGL02476:Sema4c	APN	1	36555950	missense	probably damaging	0.98
IGL02900:Sema4c	APN	1	36550745	nonsense	probably null
swirl	UTSW	1	36550311	missense	probably damaging	1.00
IGL02837:Sema4c	UTSW	1	36552884	missense	probably damaging	1.00
R0427:Sema4c	UTSW	1	36553811	nonsense	probably null
R0497:Sema4c	UTSW	1	36549608	missense	probably benign	0.04
R1066:Sema4c	UTSW	1	36550200	missense	possibly damaging	0.95
R1099:Sema4c	UTSW	1	36552110	missense	probably damaging	1.00
R1146:Sema4c	UTSW	1	36550565	missense	probably benign	0.04
R1146:Sema4c	UTSW	1	36550565	missense	probably benign	0.04
R1639:Sema4c	UTSW	1	36553534	missense	probably benign	0.00
R1644:Sema4c	UTSW	1	36550804	missense	probably damaging	1.00
R3176:Sema4c	UTSW	1	36549879	missense	possibly damaging	0.65
R3177:Sema4c	UTSW	1	36549879	missense	possibly damaging	0.65
R3276:Sema4c	UTSW	1	36549879	missense	possibly damaging	0.65
R3277:Sema4c	UTSW	1	36549879	missense	possibly damaging	0.65
R3551:Sema4c	UTSW	1	36553723	missense	probably benign	0.02
R4452:Sema4c	UTSW	1	36553756	missense	probably benign	0.31
R4883:Sema4c	UTSW	1	36552016	missense	probably damaging	0.98
R4895:Sema4c	UTSW	1	36553570	splice site	probably null
R4913:Sema4c	UTSW	1	36550185	missense	probably benign	0.11
R4944:Sema4c	UTSW	1	36550311	missense	probably damaging	1.00
R5062:Sema4c	UTSW	1	36552978	critical splice donor site	probably null
R5077:Sema4c	UTSW	1	36551731	missense	probably benign	0.20
R5109:Sema4c	UTSW	1	36552300	frame shift	probably null
R5208:Sema4c	UTSW	1	36550326	missense	probably damaging	1.00
R5551:Sema4c	UTSW	1	36552317	missense	probably damaging	1.00
R5912:Sema4c	UTSW	1	36554388	missense	possibly damaging	0.83
R6578:Sema4c	UTSW	1	36550753	missense	probably benign	0.02
R7111:Sema4c	UTSW	1	36553079	missense	possibly damaging	0.48
R7141:Sema4c	UTSW	1	36553020	missense	probably damaging	0.99
R7252:Sema4c	UTSW	1	36550015	missense	probably damaging	1.00
R7495:Sema4c	UTSW	1	36550693	missense	probably benign	0.00
R7891:Sema4c	UTSW	1	36549914	missense	probably damaging	0.98
R7895:Sema4c	UTSW	1	36553118	missense	probably damaging	1.00
R8264:Sema4c	UTSW	1	36552885	missense	probably damaging	1.00
R8478:Sema4c	UTSW	1	36551790	missense	probably benign	0.04
R8680:Sema4c	UTSW	1	36550786	missense	probably benign	0.00
R8733:Sema4c	UTSW	1	36552873	missense	probably damaging	1.00
R9017:Sema4c	UTSW	1	36552998	missense	probably damaging	1.00
R9488:Sema4c	UTSW	1	36551986	missense	probably benign
X0019:Sema4c	UTSW	1	36552996	missense	probably damaging	1.00
X0028:Sema4c	UTSW	1	36549966	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGAGCCTACAAAGTGGGGTTC -3'
(R):5'- GCCCATATGACCCAGCTAAG -3'

Sequencing Primer
(F):5'- CCTACAAAGTGGGGTTCTGGGAC -3'
(R):5'- TAAGGGTCACACCGGACTC -3'

Posted On

2022-04-18