Incidental Mutation 'R9344:Dnajc1'
ID 707659
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene Name DnaJ heat shock protein family (Hsp40) member C1
Synonyms MTJ1, Dnajl1, ERdj1, D230036H06Rik, 4733401K02Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 18210445-18402025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18289586 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 274 (V274I)
Ref Sequence ENSEMBL: ENSMUSP00000088980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000091418] [ENSMUST00000166495]
AlphaFold Q61712
Predicted Effect probably benign
Transcript: ENSMUST00000028072
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091418
AA Change: V274I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740
AA Change: V274I

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163130
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect silent
Transcript: ENSMUST00000164835
Predicted Effect probably benign
Transcript: ENSMUST00000166495
AA Change: V274I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740
AA Change: V274I

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740
AA Change: V78I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18,313,713 (GRCm39) missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18,313,645 (GRCm39) missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18,321,159 (GRCm39) intron probably benign
IGL03058:Dnajc1 APN 2 18,222,132 (GRCm39) missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18,313,645 (GRCm39) missense probably damaging 0.99
R0537:Dnajc1 UTSW 2 18,312,767 (GRCm39) missense possibly damaging 0.63
R0630:Dnajc1 UTSW 2 18,236,612 (GRCm39) missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18,289,520 (GRCm39) missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18,227,538 (GRCm39) missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18,298,838 (GRCm39) nonsense probably null
R1848:Dnajc1 UTSW 2 18,224,524 (GRCm39) missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18,312,762 (GRCm39) missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18,313,710 (GRCm39) missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18,397,286 (GRCm39) missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18,224,627 (GRCm39) missense possibly damaging 0.75
R4758:Dnajc1 UTSW 2 18,313,757 (GRCm39) nonsense probably null
R5790:Dnajc1 UTSW 2 18,311,898 (GRCm39) intron probably benign
R5802:Dnajc1 UTSW 2 18,289,550 (GRCm39) missense probably benign 0.41
R5950:Dnajc1 UTSW 2 18,311,752 (GRCm39) intron probably benign
R6049:Dnajc1 UTSW 2 18,236,511 (GRCm39) splice site probably null
R6770:Dnajc1 UTSW 2 18,222,082 (GRCm39) unclassified probably benign
R7242:Dnajc1 UTSW 2 18,298,783 (GRCm39) missense probably benign 0.06
R7462:Dnajc1 UTSW 2 18,313,710 (GRCm39) missense probably damaging 0.99
R7716:Dnajc1 UTSW 2 18,224,684 (GRCm39) missense probably benign 0.00
R7846:Dnajc1 UTSW 2 18,224,704 (GRCm39) missense possibly damaging 0.56
R7963:Dnajc1 UTSW 2 18,227,535 (GRCm39) missense possibly damaging 0.66
R8750:Dnajc1 UTSW 2 18,313,645 (GRCm39) missense probably damaging 0.99
R8967:Dnajc1 UTSW 2 18,313,757 (GRCm39) nonsense probably null
Z1176:Dnajc1 UTSW 2 18,298,798 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGATTTGATCTCCATGCAGCTC -3'
(R):5'- TAAATAATGCAGTGGTCAGTGAGC -3'

Sequencing Primer
(F):5'- GATCTCCATGCAGCTCCTTAAATC -3'
(R):5'- CAGTGGTCAGTGAGCAATATTG -3'
Posted On 2022-04-18