Incidental Mutation 'R9344:Prrc2b'
ID 707660
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Name proline-rich coiled-coil 2B
Synonyms 5830434P21Rik, Bat2l
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32041094-32124549 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32103600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1026 (G1026D)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
AlphaFold Q7TPM1
Predicted Effect probably benign
Transcript: ENSMUST00000036691
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069817
AA Change: G1026D

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: G1026D

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128936
SMART Domains Protein: ENSMUSP00000121664
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
low complexity region 159 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132459
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156313
SMART Domains Protein: ENSMUSP00000114994
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 125 140 N/A INTRINSIC
low complexity region 231 246 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32,098,731 (GRCm39) missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32,089,109 (GRCm39) splice site probably benign
IGL00977:Prrc2b APN 2 32,103,822 (GRCm39) missense probably benign 0.05
IGL01372:Prrc2b APN 2 32,113,942 (GRCm39) missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32,114,057 (GRCm39) missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32,081,513 (GRCm39) splice site probably benign
IGL02165:Prrc2b APN 2 32,104,652 (GRCm39) missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32,111,467 (GRCm39) missense probably benign 0.19
IGL02238:Prrc2b APN 2 32,103,429 (GRCm39) missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32,104,047 (GRCm39) missense probably benign 0.01
IGL02399:Prrc2b APN 2 32,116,973 (GRCm39) nonsense probably null
IGL02597:Prrc2b APN 2 32,109,625 (GRCm39) missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32,098,770 (GRCm39) missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32,084,441 (GRCm39) missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32,094,265 (GRCm39) missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32,084,498 (GRCm39) missense probably damaging 0.98
BB002:Prrc2b UTSW 2 32,094,127 (GRCm39) missense probably damaging 1.00
BB012:Prrc2b UTSW 2 32,094,127 (GRCm39) missense probably damaging 1.00
FR4304:Prrc2b UTSW 2 32,111,179 (GRCm39) missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32,102,310 (GRCm39) splice site probably benign
R0105:Prrc2b UTSW 2 32,103,323 (GRCm39) nonsense probably null
R0276:Prrc2b UTSW 2 32,109,666 (GRCm39) missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32,089,103 (GRCm39) missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32,120,672 (GRCm39) missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32,073,189 (GRCm39) missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32,103,882 (GRCm39) missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32,119,267 (GRCm39) splice site probably benign
R1282:Prrc2b UTSW 2 32,113,456 (GRCm39) missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32,090,990 (GRCm39) missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32,084,997 (GRCm39) missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32,094,301 (GRCm39) missense probably benign 0.06
R1709:Prrc2b UTSW 2 32,084,473 (GRCm39) missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32,102,234 (GRCm39) missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32,072,582 (GRCm39) missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32,113,476 (GRCm39) missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32,113,476 (GRCm39) missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32,113,476 (GRCm39) missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32,106,067 (GRCm39) missense probably benign 0.00
R2435:Prrc2b UTSW 2 32,109,741 (GRCm39) missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32,096,359 (GRCm39) missense probably benign 0.01
R4175:Prrc2b UTSW 2 32,108,820 (GRCm39) intron probably benign
R4710:Prrc2b UTSW 2 32,083,869 (GRCm39) missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32,120,637 (GRCm39) missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32,107,351 (GRCm39) splice site probably null
R4876:Prrc2b UTSW 2 32,104,212 (GRCm39) missense probably benign 0.00
R4908:Prrc2b UTSW 2 32,116,330 (GRCm39) missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32,112,323 (GRCm39) missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32,096,408 (GRCm39) missense probably benign 0.01
R5276:Prrc2b UTSW 2 32,104,734 (GRCm39) missense probably benign 0.09
R5455:Prrc2b UTSW 2 32,111,355 (GRCm39) critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32,102,144 (GRCm39) missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32,096,485 (GRCm39) missense probably benign 0.18
R5958:Prrc2b UTSW 2 32,102,092 (GRCm39) missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32,102,297 (GRCm39) missense possibly damaging 0.92
R6218:Prrc2b UTSW 2 32,098,823 (GRCm39) missense probably damaging 1.00
R6428:Prrc2b UTSW 2 32,116,508 (GRCm39) splice site probably null
R6505:Prrc2b UTSW 2 32,112,332 (GRCm39) missense probably damaging 1.00
R6812:Prrc2b UTSW 2 32,103,153 (GRCm39) missense probably benign 0.30
R6826:Prrc2b UTSW 2 32,112,300 (GRCm39) critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32,090,963 (GRCm39) missense probably benign 0.37
R7021:Prrc2b UTSW 2 32,111,498 (GRCm39) missense probably damaging 1.00
R7078:Prrc2b UTSW 2 32,103,531 (GRCm39) missense probably benign 0.01
R7081:Prrc2b UTSW 2 32,103,075 (GRCm39) missense probably benign 0.12
R7101:Prrc2b UTSW 2 32,117,005 (GRCm39) missense possibly damaging 0.68
R7215:Prrc2b UTSW 2 32,119,309 (GRCm39) missense probably damaging 1.00
R7228:Prrc2b UTSW 2 32,104,318 (GRCm39) nonsense probably null
R7566:Prrc2b UTSW 2 32,084,402 (GRCm39) missense probably benign 0.02
R7719:Prrc2b UTSW 2 32,107,280 (GRCm39) nonsense probably null
R7925:Prrc2b UTSW 2 32,094,127 (GRCm39) missense probably damaging 1.00
R7999:Prrc2b UTSW 2 32,084,426 (GRCm39) missense probably damaging 0.96
R8099:Prrc2b UTSW 2 32,098,686 (GRCm39) missense probably benign 0.06
R8154:Prrc2b UTSW 2 32,108,689 (GRCm39) missense probably benign 0.42
R8252:Prrc2b UTSW 2 32,109,392 (GRCm39) missense possibly damaging 0.80
R8379:Prrc2b UTSW 2 32,104,666 (GRCm39) missense probably damaging 0.96
R8485:Prrc2b UTSW 2 32,102,105 (GRCm39) missense possibly damaging 0.83
R8845:Prrc2b UTSW 2 32,106,162 (GRCm39) missense possibly damaging 0.89
R8845:Prrc2b UTSW 2 32,102,105 (GRCm39) missense possibly damaging 0.83
R8919:Prrc2b UTSW 2 32,104,953 (GRCm39) missense probably benign
R8982:Prrc2b UTSW 2 32,102,134 (GRCm39) missense probably damaging 1.00
R9065:Prrc2b UTSW 2 32,109,304 (GRCm39) missense probably damaging 0.99
R9127:Prrc2b UTSW 2 32,103,764 (GRCm39) missense probably damaging 1.00
R9217:Prrc2b UTSW 2 32,103,414 (GRCm39) missense probably damaging 1.00
R9338:Prrc2b UTSW 2 32,098,779 (GRCm39) missense probably damaging 1.00
R9386:Prrc2b UTSW 2 32,104,125 (GRCm39) missense probably benign
R9601:Prrc2b UTSW 2 32,090,953 (GRCm39) missense probably damaging 1.00
R9607:Prrc2b UTSW 2 32,098,794 (GRCm39) missense probably damaging 0.99
R9670:Prrc2b UTSW 2 32,103,199 (GRCm39) missense probably benign 0.00
R9706:Prrc2b UTSW 2 32,107,300 (GRCm39) missense probably benign 0.00
Z1088:Prrc2b UTSW 2 32,106,744 (GRCm39) missense probably damaging 1.00
Z1088:Prrc2b UTSW 2 32,104,441 (GRCm39) missense probably benign 0.03
Z1177:Prrc2b UTSW 2 32,116,364 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAGGCCCTGAAGGTAGAAG -3'
(R):5'- AAAGACCACTTGTGCTGCTG -3'

Sequencing Primer
(F):5'- TTAAGGCCCTGAAGGTAGAAGAGAAG -3'
(R):5'- AAGGTGAACTCTCTGAAGCCGC -3'
Posted On 2022-04-18