Incidental Mutation 'R9344:Ppp6c'
ID 707661
Institutional Source Beutler Lab
Gene Symbol Ppp6c
Ensembl Gene ENSMUSG00000026753
Gene Name protein phosphatase 6, catalytic subunit
Synonyms 2310003C10Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 39084381-39116361 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 39090052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028087] [ENSMUST00000204257] [ENSMUST00000204368] [ENSMUST00000204701]
AlphaFold Q9CQR6
Predicted Effect probably null
Transcript: ENSMUST00000028087
SMART Domains Protein: ENSMUSP00000028087
Gene: ENSMUSG00000026753

DomainStartEndE-ValueType
PP2Ac 19 289 3.36e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204257
SMART Domains Protein: ENSMUSP00000145064
Gene: ENSMUSG00000026753

DomainStartEndE-ValueType
PDB:4IYP|C 1 75 3e-14 PDB
SCOP:d1auia_ 5 57 5e-16 SMART
Blast:PP2Ac 19 74 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204368
SMART Domains Protein: ENSMUSP00000145393
Gene: ENSMUSG00000026753

DomainStartEndE-ValueType
PP2Ac 1 84 2.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204701
SMART Domains Protein: ENSMUSP00000145157
Gene: ENSMUSG00000026753

DomainStartEndE-ValueType
PP2Ac 19 267 1.94e-117 SMART
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of protein phosphatase, a component of a signaling pathway regulating cell cycle progression. Splice variants encoding different protein isoforms exist. The pseudogene of this gene is located on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal embryonic development and embryonic lethality. Mice homozygous for a conditional allele activated in skin cells exhibit increased susceptibility to chemically induced skin tumors with increased proliferative and inflammatory responses in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Ppp6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ppp6c APN 2 39,089,683 (GRCm39) missense probably benign 0.22
IGL02551:Ppp6c APN 2 39,096,669 (GRCm39) missense probably damaging 1.00
IGL02967:Ppp6c APN 2 39,116,229 (GRCm39) missense probably damaging 0.98
Pepperoncino UTSW 2 39,090,052 (GRCm39) critical splice donor site probably null
R0399:Ppp6c UTSW 2 39,090,136 (GRCm39) splice site probably benign
R0506:Ppp6c UTSW 2 39,096,660 (GRCm39) intron probably benign
R2061:Ppp6c UTSW 2 39,116,186 (GRCm39) missense probably damaging 0.99
R2180:Ppp6c UTSW 2 39,087,525 (GRCm39) missense probably benign 0.01
R5625:Ppp6c UTSW 2 39,087,453 (GRCm39) missense probably benign
R5822:Ppp6c UTSW 2 39,090,064 (GRCm39) nonsense probably null
R5994:Ppp6c UTSW 2 39,101,004 (GRCm39) missense possibly damaging 0.95
R6785:Ppp6c UTSW 2 39,087,593 (GRCm39) missense probably benign 0.00
R7346:Ppp6c UTSW 2 39,116,229 (GRCm39) missense probably damaging 0.98
R9069:Ppp6c UTSW 2 39,094,928 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGATATCAGGAGATAAACCGCC -3'
(R):5'- CACCTGCCACTGAGCTATATCC -3'

Sequencing Primer
(F):5'- TATCAGGAGATAAACCGCCATGAAC -3'
(R):5'- CCAGTCTTCATCAGGATATGCG -3'
Posted On 2022-04-18