Incidental Mutation 'R9344:Or12e9'
ID 707662
Institutional Source Beutler Lab
Gene Symbol Or12e9
Ensembl Gene ENSMUSG00000070852
Gene Name olfactory receptor family 12 subfamily E member 9
Synonyms Olfr1121, GA_x6K02T2Q125-48863863-48864807, MOR264-18
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87201878-87202822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87202161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 95 (D95V)
Ref Sequence ENSEMBL: ENSMUSP00000150120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062555] [ENSMUST00000213792]
AlphaFold L7MTT1
Predicted Effect possibly damaging
Transcript: ENSMUST00000062555
AA Change: D95V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058201
Gene: ENSMUSG00000070852
AA Change: D95V

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.3e-54 PFAM
Pfam:7tm_1 47 296 3.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213792
AA Change: D95V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Or12e9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02534:Or12e9 APN 2 87,202,598 (GRCm39) missense probably benign
IGL03280:Or12e9 APN 2 87,202,467 (GRCm39) missense probably damaging 1.00
R0501:Or12e9 UTSW 2 87,201,896 (GRCm39) missense probably damaging 0.96
R1350:Or12e9 UTSW 2 87,202,701 (GRCm39) missense probably benign
R1713:Or12e9 UTSW 2 87,202,290 (GRCm39) missense probably damaging 1.00
R2404:Or12e9 UTSW 2 87,202,568 (GRCm39) missense probably benign 0.09
R4737:Or12e9 UTSW 2 87,202,665 (GRCm39) missense probably damaging 0.99
R4825:Or12e9 UTSW 2 87,202,432 (GRCm39) nonsense probably null
R5109:Or12e9 UTSW 2 87,201,878 (GRCm39) start codon destroyed probably null 0.04
R5200:Or12e9 UTSW 2 87,202,446 (GRCm39) missense probably damaging 0.99
R6393:Or12e9 UTSW 2 87,201,909 (GRCm39) missense probably damaging 1.00
R6658:Or12e9 UTSW 2 87,202,497 (GRCm39) missense probably benign 0.01
R7011:Or12e9 UTSW 2 87,202,604 (GRCm39) missense possibly damaging 0.74
R7427:Or12e9 UTSW 2 87,202,034 (GRCm39) missense probably benign 0.01
R7428:Or12e9 UTSW 2 87,202,034 (GRCm39) missense probably benign 0.01
R7671:Or12e9 UTSW 2 87,202,613 (GRCm39) missense probably damaging 1.00
R8268:Or12e9 UTSW 2 87,202,332 (GRCm39) missense probably damaging 0.97
R9015:Or12e9 UTSW 2 87,202,485 (GRCm39) missense possibly damaging 0.48
R9468:Or12e9 UTSW 2 87,202,116 (GRCm39) missense probably damaging 1.00
R9492:Or12e9 UTSW 2 87,201,960 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCTCCAGAGCTTTCTGTTTGG -3'
(R):5'- TTTGCCCAACCTGAAACGG -3'

Sequencing Primer
(F):5'- TGGGGTGTTCTCCATAATGTAC -3'
(R):5'- TGAAACGGCATGCCACC -3'
Posted On 2022-04-18