Incidental Mutation 'R9344:Duox1'
ID 707664
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms THOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 122315672-122347972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122337682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1096 (M1096K)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
AlphaFold A2AQ92
Predicted Effect probably benign
Transcript: ENSMUST00000099461
AA Change: M1096K

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: M1096K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,770,772 V31A possibly damaging Het
Adss A G 1: 177,769,961 Y378H probably damaging Het
Aldh1a1 T A 19: 20,630,786 V324D probably damaging Het
Ankrd33b A G 15: 31,297,757 S285P probably damaging Het
Arel1 C T 12: 84,934,597 G269S probably damaging Het
Arhgap44 A G 11: 65,162,637 M1T probably null Het
Arpin C T 7: 79,928,235 V149I probably benign Het
Arpp21 A G 9: 112,185,652 L28P possibly damaging Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Ccr8 G A 9: 120,094,067 V83I probably damaging Het
Cnksr1 T C 4: 134,236,197 E58G probably damaging Het
Dctn2 T A 10: 127,278,215 H341Q probably damaging Het
Ddx21 C A 10: 62,593,046 A362S possibly damaging Het
Dnajc1 C T 2: 18,284,775 V274I probably benign Het
Dock3 A C 9: 106,993,564 C550W probably damaging Het
Dst T C 1: 34,181,595 L2160S probably damaging Het
Dync2h1 A T 9: 7,148,659 D928E probably benign Het
E030025P04Rik C T 11: 109,139,628 probably null Het
Eid2b T C 7: 28,278,166 M129T possibly damaging Het
Fnip2 G A 3: 79,500,410 S288F possibly damaging Het
Grm4 G T 17: 27,434,763 R738S probably benign Het
Gsto2 A G 19: 47,876,445 D139G probably benign Het
Herc2 T A 7: 56,122,364 V1097E probably benign Het
Impg1 G A 9: 80,404,758 A181V probably benign Het
Irs2 G T 8: 11,007,289 S381* probably null Het
Lrrd1 A C 5: 3,858,819 D697A possibly damaging Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncapg2 G A 12: 116,424,653 R319H probably damaging Het
Nid1 A G 13: 13,478,309 Y568C probably damaging Het
Noc2l G A 4: 156,240,673 C325Y probably damaging Het
Olfr1121 A T 2: 87,371,817 D95V possibly damaging Het
Olfr23 C A 11: 73,940,918 S224Y possibly damaging Het
Pde2a G T 7: 101,495,684 V169F possibly damaging Het
Pon3 T C 6: 5,221,586 K348R probably benign Het
Ppp6c A G 2: 39,200,040 probably null Het
Prrc2b G A 2: 32,213,588 G1026D probably benign Het
Psg22 A T 7: 18,726,891 T482S possibly damaging Het
Rdh19 G A 10: 127,856,871 V136M probably damaging Het
Sbf2 T A 7: 110,341,328 N1275I probably benign Het
Sema4c T C 1: 36,553,314 N182D probably damaging Het
Slc7a12 T A 3: 14,505,431 H414Q probably damaging Het
Slitrk5 A G 14: 111,679,270 I109V probably damaging Het
Spag17 C T 3: 100,103,477 P2096S probably benign Het
Steap1 T A 5: 5,736,459 D326V probably damaging Het
Tacr1 C T 6: 82,403,866 T86I probably damaging Het
Tenm4 C T 7: 96,896,145 T2493I probably damaging Het
Tet2 A G 3: 133,469,354 S1411P possibly damaging Het
Tom1 C T 8: 75,058,448 R303C probably damaging Het
Trav7n-4 T A 14: 53,091,743 I70N possibly damaging Het
Utrn A C 10: 12,684,531 V1338G probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r122 A T 7: 21,133,346 H261Q probably benign Het
Vmn1r40 G T 6: 89,714,253 L17F probably benign Het
Vmn2r54 A G 7: 12,632,356 V217A probably benign Het
Vmn2r55 C A 7: 12,651,855 G733* probably null Het
Vmn2r98 A T 17: 19,066,515 N425I probably benign Het
Vps51 C T 19: 6,076,315 V136I unknown Het
Zfp184 T C 13: 21,960,241 C706R probably damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
antiquity UTSW 2 122340201 missense probably damaging 1.00
Dejavous UTSW 2 122320864 missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122319472 missense probably benign 0.01
R5032_duox1_732 UTSW 2 122337317 missense probably benign
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 splice site probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
R8717:Duox1 UTSW 2 122337671 missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122344705 missense probably damaging 1.00
R9196:Duox1 UTSW 2 122320208 missense probably benign 0.08
R9397:Duox1 UTSW 2 122320302 missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122326426 missense probably benign 0.01
R9510:Duox1 UTSW 2 122329542 missense possibly damaging 0.92
R9521:Duox1 UTSW 2 122328735 missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9565:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9569:Duox1 UTSW 2 122318490 missense probably benign
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTGACACACATCCCGATG -3'
(R):5'- GGGCTTCATTTCATCCCACAG -3'

Sequencing Primer
(F):5'- CCCGATGTAGGGTTGGGG -3'
(R):5'- CCTTATCGACATTAAAGTTAGGTGC -3'
Posted On 2022-04-18