Incidental Mutation 'R9344:Itprid1'
ID 707674
Institutional Source Beutler Lab
Gene Symbol Itprid1
Ensembl Gene ENSMUSG00000037973
Gene Name ITPR interacting domain containing 1
Synonyms D530004J12Rik, Ccdc129
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 55813880-55955720 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55955470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1026 (T1026I)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
AlphaFold Q14B48
Predicted Effect probably benign
Transcript: ENSMUST00000044729
AA Change: T1026I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: T1026I

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Itprid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itprid1 APN 6 55,945,022 (GRCm39) missense possibly damaging 0.90
IGL01317:Itprid1 APN 6 55,944,790 (GRCm39) missense possibly damaging 0.77
IGL01390:Itprid1 APN 6 55,874,983 (GRCm39) missense probably benign 0.41
IGL01696:Itprid1 APN 6 55,874,680 (GRCm39) missense probably benign 0.40
IGL01941:Itprid1 APN 6 55,945,030 (GRCm39) missense probably benign
IGL01967:Itprid1 APN 6 55,874,896 (GRCm39) missense probably damaging 0.99
IGL02071:Itprid1 APN 6 55,944,710 (GRCm39) nonsense probably null
IGL02232:Itprid1 APN 6 55,944,922 (GRCm39) missense unknown
IGL02268:Itprid1 APN 6 55,861,673 (GRCm39) splice site probably benign
IGL02440:Itprid1 APN 6 55,861,713 (GRCm39) missense possibly damaging 0.95
IGL02614:Itprid1 APN 6 55,945,262 (GRCm39) missense probably damaging 0.99
IGL02626:Itprid1 APN 6 55,945,631 (GRCm39) missense probably benign 0.03
IGL02674:Itprid1 APN 6 55,874,913 (GRCm39) missense probably benign 0.04
IGL02836:Itprid1 APN 6 55,875,075 (GRCm39) missense probably damaging 1.00
IGL02884:Itprid1 APN 6 55,851,339 (GRCm39) splice site probably null
IGL02889:Itprid1 APN 6 55,878,443 (GRCm39) missense possibly damaging 0.46
IGL03103:Itprid1 APN 6 55,945,144 (GRCm39) missense possibly damaging 0.59
IGL03117:Itprid1 APN 6 55,875,114 (GRCm39) missense probably benign 0.25
IGL03343:Itprid1 APN 6 55,945,569 (GRCm39) missense probably damaging 1.00
BB006:Itprid1 UTSW 6 55,874,946 (GRCm39) missense probably damaging 1.00
BB016:Itprid1 UTSW 6 55,874,946 (GRCm39) missense probably damaging 1.00
PIT4418001:Itprid1 UTSW 6 55,945,330 (GRCm39) missense probably damaging 1.00
R0054:Itprid1 UTSW 6 55,849,457 (GRCm39) utr 5 prime probably benign
R0200:Itprid1 UTSW 6 55,874,941 (GRCm39) missense probably benign 0.10
R0245:Itprid1 UTSW 6 55,874,992 (GRCm39) missense probably damaging 1.00
R0320:Itprid1 UTSW 6 55,953,432 (GRCm39) missense probably damaging 1.00
R0326:Itprid1 UTSW 6 55,875,228 (GRCm39) missense possibly damaging 0.61
R0357:Itprid1 UTSW 6 55,945,019 (GRCm39) missense probably benign 0.13
R1109:Itprid1 UTSW 6 55,945,245 (GRCm39) missense probably damaging 1.00
R1118:Itprid1 UTSW 6 55,866,155 (GRCm39) missense probably damaging 1.00
R1119:Itprid1 UTSW 6 55,866,155 (GRCm39) missense probably damaging 1.00
R1462:Itprid1 UTSW 6 55,952,649 (GRCm39) missense probably damaging 1.00
R1462:Itprid1 UTSW 6 55,952,649 (GRCm39) missense probably damaging 1.00
R1588:Itprid1 UTSW 6 55,955,488 (GRCm39) missense possibly damaging 0.72
R1678:Itprid1 UTSW 6 55,945,499 (GRCm39) missense probably benign 0.35
R1680:Itprid1 UTSW 6 55,945,751 (GRCm39) missense probably damaging 1.00
R1728:Itprid1 UTSW 6 55,945,526 (GRCm39) missense probably benign 0.01
R1729:Itprid1 UTSW 6 55,945,526 (GRCm39) missense probably benign 0.01
R1737:Itprid1 UTSW 6 55,945,289 (GRCm39) missense probably damaging 1.00
R1771:Itprid1 UTSW 6 55,875,132 (GRCm39) missense probably benign 0.40
R1784:Itprid1 UTSW 6 55,945,526 (GRCm39) missense probably benign 0.01
R1936:Itprid1 UTSW 6 55,874,666 (GRCm39) missense probably damaging 1.00
R1995:Itprid1 UTSW 6 55,945,694 (GRCm39) missense probably benign 0.03
R2037:Itprid1 UTSW 6 55,874,860 (GRCm39) missense probably benign 0.00
R2137:Itprid1 UTSW 6 55,866,174 (GRCm39) missense probably damaging 1.00
R2190:Itprid1 UTSW 6 55,874,685 (GRCm39) missense possibly damaging 0.87
R2191:Itprid1 UTSW 6 55,944,704 (GRCm39) missense probably benign 0.06
R2234:Itprid1 UTSW 6 55,874,797 (GRCm39) missense possibly damaging 0.67
R2235:Itprid1 UTSW 6 55,874,797 (GRCm39) missense possibly damaging 0.67
R3793:Itprid1 UTSW 6 55,952,588 (GRCm39) missense possibly damaging 0.80
R3923:Itprid1 UTSW 6 55,945,045 (GRCm39) missense probably benign 0.19
R3959:Itprid1 UTSW 6 55,874,725 (GRCm39) missense probably benign
R4332:Itprid1 UTSW 6 55,945,220 (GRCm39) missense possibly damaging 0.95
R4485:Itprid1 UTSW 6 55,864,051 (GRCm39) missense probably benign 0.00
R4688:Itprid1 UTSW 6 55,944,132 (GRCm39) splice site probably null
R4916:Itprid1 UTSW 6 55,955,175 (GRCm39) missense possibly damaging 0.77
R5201:Itprid1 UTSW 6 55,944,991 (GRCm39) missense probably benign 0.03
R5383:Itprid1 UTSW 6 55,955,275 (GRCm39) missense probably benign 0.38
R5450:Itprid1 UTSW 6 55,945,796 (GRCm39) critical splice donor site probably null
R5542:Itprid1 UTSW 6 55,955,380 (GRCm39) missense probably damaging 0.99
R5819:Itprid1 UTSW 6 55,874,876 (GRCm39) missense probably benign 0.18
R5935:Itprid1 UTSW 6 55,874,754 (GRCm39) nonsense probably null
R6034:Itprid1 UTSW 6 55,944,666 (GRCm39) missense possibly damaging 0.94
R6034:Itprid1 UTSW 6 55,944,666 (GRCm39) missense possibly damaging 0.94
R6209:Itprid1 UTSW 6 55,851,306 (GRCm39) missense probably damaging 1.00
R6246:Itprid1 UTSW 6 55,944,657 (GRCm39) missense probably damaging 1.00
R6463:Itprid1 UTSW 6 55,945,663 (GRCm39) missense probably benign 0.17
R6490:Itprid1 UTSW 6 55,953,405 (GRCm39) missense probably damaging 1.00
R6948:Itprid1 UTSW 6 55,955,470 (GRCm39) missense probably benign
R7148:Itprid1 UTSW 6 55,874,671 (GRCm39) missense probably damaging 1.00
R7382:Itprid1 UTSW 6 55,955,404 (GRCm39) missense probably benign 0.02
R7403:Itprid1 UTSW 6 55,953,399 (GRCm39) nonsense probably null
R7846:Itprid1 UTSW 6 55,955,320 (GRCm39) missense possibly damaging 0.89
R7929:Itprid1 UTSW 6 55,874,946 (GRCm39) missense probably damaging 1.00
R8054:Itprid1 UTSW 6 55,953,424 (GRCm39) missense probably damaging 0.98
R8438:Itprid1 UTSW 6 55,874,878 (GRCm39) missense probably damaging 1.00
R8497:Itprid1 UTSW 6 55,875,179 (GRCm39) missense probably benign 0.02
R8677:Itprid1 UTSW 6 55,849,579 (GRCm39) missense probably benign 0.00
R9090:Itprid1 UTSW 6 55,944,051 (GRCm39) missense probably benign 0.28
R9196:Itprid1 UTSW 6 55,952,613 (GRCm39) missense probably damaging 1.00
R9271:Itprid1 UTSW 6 55,944,051 (GRCm39) missense probably benign 0.28
R9384:Itprid1 UTSW 6 55,952,613 (GRCm39) missense probably damaging 1.00
R9558:Itprid1 UTSW 6 55,944,969 (GRCm39) missense possibly damaging 0.94
R9711:Itprid1 UTSW 6 55,864,018 (GRCm39) missense probably damaging 1.00
Z1177:Itprid1 UTSW 6 55,945,219 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTGTTCAAACCCATGCTG -3'
(R):5'- GACACATGCTCTATCAGGATAGC -3'

Sequencing Primer
(F):5'- AGTAGTGGCCAGTGGACTC -3'
(R):5'- GCAATCATATGCTACTCAGTGAC -3'
Posted On 2022-04-18