Incidental Mutation 'R9344:Ccr8'
ID 707692
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Name C-C motif chemokine receptor 8
Synonyms Cmkbr8
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119921199-119923972 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119923133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 83 (V83I)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
AlphaFold P56484
Predicted Effect probably damaging
Transcript: ENSMUST00000048777
AA Change: V83I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: V83I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 119,923,691 (GRCm39) missense probably damaging 1.00
IGL02558:Ccr8 APN 9 119,923,724 (GRCm39) missense probably benign 0.01
IGL02966:Ccr8 APN 9 119,923,206 (GRCm39) missense probably damaging 0.96
IGL03135:Ccr8 APN 9 119,923,689 (GRCm39) missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 119,923,976 (GRCm39) splice site probably null
R0739:Ccr8 UTSW 9 119,923,415 (GRCm39) missense probably damaging 1.00
R1069:Ccr8 UTSW 9 119,923,283 (GRCm39) missense probably benign 0.00
R4766:Ccr8 UTSW 9 119,923,530 (GRCm39) missense probably damaging 1.00
R4934:Ccr8 UTSW 9 119,923,815 (GRCm39) missense probably benign
R5116:Ccr8 UTSW 9 119,923,095 (GRCm39) missense probably benign 0.39
R5942:Ccr8 UTSW 9 119,923,772 (GRCm39) missense probably damaging 0.99
R5957:Ccr8 UTSW 9 119,922,893 (GRCm39) missense probably damaging 0.99
R5996:Ccr8 UTSW 9 119,923,529 (GRCm39) missense probably damaging 1.00
R7223:Ccr8 UTSW 9 119,923,683 (GRCm39) missense probably damaging 0.99
R8037:Ccr8 UTSW 9 119,923,436 (GRCm39) missense probably benign
R8332:Ccr8 UTSW 9 119,923,440 (GRCm39) missense probably damaging 1.00
R8962:Ccr8 UTSW 9 119,923,613 (GRCm39) missense possibly damaging 0.56
Z1177:Ccr8 UTSW 9 119,923,565 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGTCACGATGACCGACTACTAC -3'
(R):5'- CTTGATGGCATAGACAGCGTGG -3'

Sequencing Primer
(F):5'- GATGACCGACTACTACCCTGATTTC -3'
(R):5'- GTGGACAATAGCCAGATACCTGTC -3'
Posted On 2022-04-18