Incidental Mutation 'R9344:Ncapg2'
ID 707702
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Name non-SMC condensin II complex, subunit G2
Synonyms 5830426I05Rik, Mtb, mCAP-G2, Luzp5
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116368969-116427152 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 116388273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 319 (R319H)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
AlphaFold Q6DFV1
Predicted Effect probably damaging
Transcript: ENSMUST00000084828
AA Change: R319H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: R319H

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116,388,270 (GRCm39) missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116,370,850 (GRCm39) utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116,390,331 (GRCm39) missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116,389,438 (GRCm39) missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116,407,952 (GRCm39) missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116,424,203 (GRCm39) missense probably benign
IGL02409:Ncapg2 APN 12 116,384,337 (GRCm39) missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116,384,309 (GRCm39) missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116,389,526 (GRCm39) critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116,415,894 (GRCm39) missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116,415,993 (GRCm39) splice site probably benign
IGL03199:Ncapg2 APN 12 116,382,856 (GRCm39) missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116,403,677 (GRCm39) missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116,402,255 (GRCm39) missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116,393,455 (GRCm39) missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116,384,303 (GRCm39) splice site probably null
R0379:Ncapg2 UTSW 12 116,406,695 (GRCm39) missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116,386,835 (GRCm39) missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116,376,779 (GRCm39) nonsense probably null
R1016:Ncapg2 UTSW 12 116,402,295 (GRCm39) missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116,424,186 (GRCm39) missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116,398,198 (GRCm39) splice site probably benign
R1596:Ncapg2 UTSW 12 116,382,856 (GRCm39) missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116,398,305 (GRCm39) frame shift probably null
R1752:Ncapg2 UTSW 12 116,390,338 (GRCm39) missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116,414,095 (GRCm39) splice site probably null
R2266:Ncapg2 UTSW 12 116,393,296 (GRCm39) missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116,384,349 (GRCm39) nonsense probably null
R2924:Ncapg2 UTSW 12 116,402,349 (GRCm39) missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116,402,349 (GRCm39) missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116,370,938 (GRCm39) splice site probably benign
R3829:Ncapg2 UTSW 12 116,370,938 (GRCm39) splice site probably benign
R4384:Ncapg2 UTSW 12 116,403,497 (GRCm39) critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116,389,407 (GRCm39) missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116,404,238 (GRCm39) missense probably benign
R4821:Ncapg2 UTSW 12 116,379,077 (GRCm39) missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116,404,208 (GRCm39) missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116,391,406 (GRCm39) missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116,391,414 (GRCm39) missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116,390,257 (GRCm39) missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116,376,697 (GRCm39) missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116,389,420 (GRCm39) missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116,393,277 (GRCm39) missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116,388,291 (GRCm39) missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116,390,227 (GRCm39) missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116,406,641 (GRCm39) missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116,401,631 (GRCm39) missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116,391,376 (GRCm39) missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116,398,281 (GRCm39) missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116,390,202 (GRCm39) missense probably benign
R7069:Ncapg2 UTSW 12 116,388,337 (GRCm39) splice site probably null
R7339:Ncapg2 UTSW 12 116,378,454 (GRCm39) missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116,414,033 (GRCm39) missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116,382,888 (GRCm39) missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116,382,897 (GRCm39) missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116,390,197 (GRCm39) missense probably benign
R8132:Ncapg2 UTSW 12 116,407,967 (GRCm39) missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116,376,036 (GRCm39) missense probably benign 0.00
R8351:Ncapg2 UTSW 12 116,403,647 (GRCm39) missense possibly damaging 0.80
R8526:Ncapg2 UTSW 12 116,403,679 (GRCm39) missense probably benign 0.00
R8692:Ncapg2 UTSW 12 116,414,049 (GRCm39) missense probably damaging 1.00
R8739:Ncapg2 UTSW 12 116,379,098 (GRCm39) missense possibly damaging 0.75
R8766:Ncapg2 UTSW 12 116,390,356 (GRCm39) missense probably damaging 1.00
R8929:Ncapg2 UTSW 12 116,415,983 (GRCm39) missense probably damaging 1.00
R9046:Ncapg2 UTSW 12 116,376,145 (GRCm39) missense probably benign 0.01
R9187:Ncapg2 UTSW 12 116,402,287 (GRCm39) missense probably damaging 1.00
R9444:Ncapg2 UTSW 12 116,370,863 (GRCm39) missense probably damaging 1.00
R9580:Ncapg2 UTSW 12 116,424,228 (GRCm39) missense probably damaging 1.00
R9634:Ncapg2 UTSW 12 116,379,077 (GRCm39) missense probably damaging 0.99
R9749:Ncapg2 UTSW 12 116,411,368 (GRCm39) nonsense probably null
X0020:Ncapg2 UTSW 12 116,388,327 (GRCm39) missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116,402,225 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCTGTAGGTCTTGCCAG -3'
(R):5'- CAGTGACTGTTTACTTAGCACAG -3'

Sequencing Primer
(F):5'- CTGTAGGTCTTGCCAGAGAATG -3'
(R):5'- CCATTTACATGTGAGATTGAGGCAG -3'
Posted On 2022-04-18