Incidental Mutation 'R9344:Nid1'
ID 707703
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Name nidogen 1
Synonyms nidogen-1, entactin, entactin 1, entactin-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 13612252-13686849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13652894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 568 (Y568C)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
AlphaFold P10493
PDB Structure NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005532
AA Change: Y568C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: Y568C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13,650,977 (GRCm39) missense probably damaging 1.00
IGL02126:Nid1 APN 13 13,663,743 (GRCm39) splice site probably null
IGL02452:Nid1 APN 13 13,683,305 (GRCm39) missense probably benign 0.17
IGL02806:Nid1 APN 13 13,642,897 (GRCm39) missense probably benign 0.00
IGL02966:Nid1 APN 13 13,656,806 (GRCm39) missense probably benign 0.09
IGL03136:Nid1 APN 13 13,675,084 (GRCm39) missense probably benign 0.33
IGL03411:Nid1 APN 13 13,612,474 (GRCm39) missense probably damaging 0.98
R0384:Nid1 UTSW 13 13,638,421 (GRCm39) missense probably benign 0.34
R0413:Nid1 UTSW 13 13,656,681 (GRCm39) missense probably benign 0.01
R1257:Nid1 UTSW 13 13,658,375 (GRCm39) missense probably benign 0.01
R1390:Nid1 UTSW 13 13,650,831 (GRCm39) missense probably damaging 1.00
R1397:Nid1 UTSW 13 13,683,380 (GRCm39) missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13,675,058 (GRCm39) missense probably benign 0.00
R2058:Nid1 UTSW 13 13,675,058 (GRCm39) missense probably benign 0.00
R2059:Nid1 UTSW 13 13,675,058 (GRCm39) missense probably benign 0.00
R2132:Nid1 UTSW 13 13,684,071 (GRCm39) missense probably benign 0.04
R2140:Nid1 UTSW 13 13,674,253 (GRCm39) missense probably damaging 1.00
R2195:Nid1 UTSW 13 13,650,788 (GRCm39) missense probably damaging 1.00
R2237:Nid1 UTSW 13 13,675,070 (GRCm39) missense probably benign
R2312:Nid1 UTSW 13 13,675,078 (GRCm39) missense probably benign 0.15
R2987:Nid1 UTSW 13 13,674,258 (GRCm39) missense probably benign 0.40
R3696:Nid1 UTSW 13 13,661,344 (GRCm39) missense probably damaging 0.99
R3697:Nid1 UTSW 13 13,661,344 (GRCm39) missense probably damaging 0.99
R3698:Nid1 UTSW 13 13,661,344 (GRCm39) missense probably damaging 0.99
R3772:Nid1 UTSW 13 13,651,003 (GRCm39) splice site probably benign
R4092:Nid1 UTSW 13 13,661,224 (GRCm39) missense probably damaging 0.96
R4126:Nid1 UTSW 13 13,650,957 (GRCm39) missense probably damaging 1.00
R4128:Nid1 UTSW 13 13,650,957 (GRCm39) missense probably damaging 1.00
R4680:Nid1 UTSW 13 13,647,437 (GRCm39) missense probably damaging 1.00
R4717:Nid1 UTSW 13 13,681,086 (GRCm39) missense probably benign 0.00
R4783:Nid1 UTSW 13 13,674,326 (GRCm39) missense probably damaging 0.97
R4812:Nid1 UTSW 13 13,681,053 (GRCm39) nonsense probably null
R4834:Nid1 UTSW 13 13,683,408 (GRCm39) missense probably damaging 1.00
R4915:Nid1 UTSW 13 13,674,171 (GRCm39) missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13,684,596 (GRCm39) missense probably damaging 1.00
R5101:Nid1 UTSW 13 13,658,339 (GRCm39) missense probably damaging 1.00
R5276:Nid1 UTSW 13 13,643,157 (GRCm39) missense probably damaging 0.99
R5427:Nid1 UTSW 13 13,658,268 (GRCm39) missense probably damaging 1.00
R5447:Nid1 UTSW 13 13,612,495 (GRCm39) missense probably benign 0.00
R5507:Nid1 UTSW 13 13,663,622 (GRCm39) nonsense probably null
R5663:Nid1 UTSW 13 13,647,419 (GRCm39) missense probably damaging 1.00
R5868:Nid1 UTSW 13 13,663,742 (GRCm39) critical splice donor site probably null
R6313:Nid1 UTSW 13 13,638,367 (GRCm39) missense probably benign 0.01
R6761:Nid1 UTSW 13 13,656,620 (GRCm39) missense probably benign 0.22
R7069:Nid1 UTSW 13 13,683,353 (GRCm39) missense probably benign
R7208:Nid1 UTSW 13 13,642,970 (GRCm39) missense probably benign 0.01
R7284:Nid1 UTSW 13 13,663,675 (GRCm39) missense probably benign 0.01
R7434:Nid1 UTSW 13 13,643,049 (GRCm39) missense probably benign
R7449:Nid1 UTSW 13 13,656,636 (GRCm39) missense probably damaging 1.00
R7574:Nid1 UTSW 13 13,643,028 (GRCm39) missense probably benign
R7762:Nid1 UTSW 13 13,663,630 (GRCm39) missense probably damaging 1.00
R7887:Nid1 UTSW 13 13,674,318 (GRCm39) missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13,612,416 (GRCm39) missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13,650,759 (GRCm39) missense probably damaging 0.99
R8756:Nid1 UTSW 13 13,683,386 (GRCm39) missense probably benign 0.32
R8903:Nid1 UTSW 13 13,638,515 (GRCm39) missense probably benign 0.00
R9084:Nid1 UTSW 13 13,652,925 (GRCm39) critical splice donor site probably null
R9297:Nid1 UTSW 13 13,650,897 (GRCm39) missense possibly damaging 0.92
R9552:Nid1 UTSW 13 13,677,045 (GRCm39) missense probably damaging 0.99
X0028:Nid1 UTSW 13 13,684,119 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GACAGGCCTGTTTTACTTTCCAG -3'
(R):5'- TCTTCAAGCGTGTCTTCTGCAG -3'

Sequencing Primer
(F):5'- ACTTTCCAGGGGGCGAGTTTAC -3'
(R):5'- CTTCTGCAGTGCTTAGGGAGAAAG -3'
Posted On 2022-04-18