Incidental Mutation 'R9344:Slitrk5'
ID 707706
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene Name SLIT and NTRK-like family, member 5
Synonyms 2610019D03Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 111912547-111920576 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111916702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 109 (I109V)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
AlphaFold Q810B7
Predicted Effect probably damaging
Transcript: ENSMUST00000042767
AA Change: I109V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: I109V

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227891
AA Change: I109V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111,918,097 (GRCm39) missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111,918,526 (GRCm39) missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111,916,432 (GRCm39) missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111,916,717 (GRCm39) missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111,918,026 (GRCm39) missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111,919,055 (GRCm39) missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111,918,256 (GRCm39) missense probably benign
R0392:Slitrk5 UTSW 14 111,916,465 (GRCm39) missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111,918,121 (GRCm39) missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111,917,821 (GRCm39) missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111,917,951 (GRCm39) missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111,917,821 (GRCm39) missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111,917,621 (GRCm39) missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111,917,621 (GRCm39) missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111,917,229 (GRCm39) nonsense probably null
R3886:Slitrk5 UTSW 14 111,917,229 (GRCm39) nonsense probably null
R3888:Slitrk5 UTSW 14 111,917,229 (GRCm39) nonsense probably null
R4962:Slitrk5 UTSW 14 111,918,679 (GRCm39) missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111,917,648 (GRCm39) missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111,918,316 (GRCm39) missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111,916,852 (GRCm39) missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111,919,118 (GRCm39) missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111,919,055 (GRCm39) missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111,917,345 (GRCm39) missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111,917,030 (GRCm39) missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111,919,157 (GRCm39) missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6225:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6230:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6337:Slitrk5 UTSW 14 111,917,684 (GRCm39) missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111,917,534 (GRCm39) missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111,917,726 (GRCm39) missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111,919,085 (GRCm39) missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111,918,268 (GRCm39) missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111,918,131 (GRCm39) missense probably benign 0.32
R8532:Slitrk5 UTSW 14 111,916,909 (GRCm39) missense probably benign
R8994:Slitrk5 UTSW 14 111,918,227 (GRCm39) missense probably benign 0.00
R9374:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
R9499:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
R9500:Slitrk5 UTSW 14 111,916,726 (GRCm39) missense possibly damaging 0.89
R9512:Slitrk5 UTSW 14 111,917,252 (GRCm39) missense probably damaging 1.00
R9552:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
Z1177:Slitrk5 UTSW 14 111,917,285 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGGGGAAATCTGTGACAATGC -3'
(R):5'- TGCAGTTTCCCAAAAGCATTG -3'

Sequencing Primer
(F):5'- ACAATGCATGTCCTTGTGAGG -3'
(R):5'- CATCTCGCAGAAGTTCCA -3'
Posted On 2022-04-18