Incidental Mutation 'R9344:Vmn2r98'
ID 707709
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19066515 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 425 (N425I)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: N425I

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: N425I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,770,772 V31A possibly damaging Het
Adss A G 1: 177,769,961 Y378H probably damaging Het
Aldh1a1 T A 19: 20,630,786 V324D probably damaging Het
Ankrd33b A G 15: 31,297,757 S285P probably damaging Het
Arel1 C T 12: 84,934,597 G269S probably damaging Het
Arhgap44 A G 11: 65,162,637 M1T probably null Het
Arpin C T 7: 79,928,235 V149I probably benign Het
Arpp21 A G 9: 112,185,652 L28P possibly damaging Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Ccr8 G A 9: 120,094,067 V83I probably damaging Het
Cnksr1 T C 4: 134,236,197 E58G probably damaging Het
Dctn2 T A 10: 127,278,215 H341Q probably damaging Het
Ddx21 C A 10: 62,593,046 A362S possibly damaging Het
Dnajc1 C T 2: 18,284,775 V274I probably benign Het
Dock3 A C 9: 106,993,564 C550W probably damaging Het
Dst T C 1: 34,181,595 L2160S probably damaging Het
Duox1 T A 2: 122,337,682 M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 D928E probably benign Het
E030025P04Rik C T 11: 109,139,628 probably null Het
Eid2b T C 7: 28,278,166 M129T possibly damaging Het
Fnip2 G A 3: 79,500,410 S288F possibly damaging Het
Grm4 G T 17: 27,434,763 R738S probably benign Het
Gsto2 A G 19: 47,876,445 D139G probably benign Het
Herc2 T A 7: 56,122,364 V1097E probably benign Het
Impg1 G A 9: 80,404,758 A181V probably benign Het
Irs2 G T 8: 11,007,289 S381* probably null Het
Lrrd1 A C 5: 3,858,819 D697A possibly damaging Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncapg2 G A 12: 116,424,653 R319H probably damaging Het
Nid1 A G 13: 13,478,309 Y568C probably damaging Het
Noc2l G A 4: 156,240,673 C325Y probably damaging Het
Olfr1121 A T 2: 87,371,817 D95V possibly damaging Het
Olfr23 C A 11: 73,940,918 S224Y possibly damaging Het
Pde2a G T 7: 101,495,684 V169F possibly damaging Het
Pon3 T C 6: 5,221,586 K348R probably benign Het
Ppp6c A G 2: 39,200,040 probably null Het
Prrc2b G A 2: 32,213,588 G1026D probably benign Het
Psg22 A T 7: 18,726,891 T482S possibly damaging Het
Rdh19 G A 10: 127,856,871 V136M probably damaging Het
Sbf2 T A 7: 110,341,328 N1275I probably benign Het
Sema4c T C 1: 36,553,314 N182D probably damaging Het
Slc7a12 T A 3: 14,505,431 H414Q probably damaging Het
Slitrk5 A G 14: 111,679,270 I109V probably damaging Het
Spag17 C T 3: 100,103,477 P2096S probably benign Het
Steap1 T A 5: 5,736,459 D326V probably damaging Het
Tacr1 C T 6: 82,403,866 T86I probably damaging Het
Tenm4 C T 7: 96,896,145 T2493I probably damaging Het
Tet2 A G 3: 133,469,354 S1411P possibly damaging Het
Tom1 C T 8: 75,058,448 R303C probably damaging Het
Trav7n-4 T A 14: 53,091,743 I70N possibly damaging Het
Utrn A C 10: 12,684,531 V1338G probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r122 A T 7: 21,133,346 H261Q probably benign Het
Vmn1r40 G T 6: 89,714,253 L17F probably benign Het
Vmn2r54 A G 7: 12,632,356 V217A probably benign Het
Vmn2r55 C A 7: 12,651,855 G733* probably null Het
Vps51 C T 19: 6,076,315 V136I unknown Het
Zfp184 T C 13: 21,960,241 C706R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGTCATGTGTTGGGAAACTGTC -3'
(R):5'- TGCTCCTGGTATCTTGTACATG -3'

Sequencing Primer
(F):5'- CATGTGTTGGGAAACTGTCAAACC -3'
(R):5'- GCTCCTGGTATCTTGTACATGACTTC -3'
Posted On 2022-04-18