Incidental Mutation 'R9344:Grm4'
ID 707710
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Name glutamate receptor, metabotropic 4
Synonyms Gprc1d, mGluR4
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27641361-27732800 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 27653737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 738 (R738S)
Ref Sequence ENSEMBL: ENSMUSP00000112578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118161
AA Change: R738S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: R738S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118489
AA Change: R738S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239
AA Change: R738S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231290
AA Change: R738S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000231416
AA Change: R483S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000231809
AA Change: R691S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27,653,711 (GRCm39) nonsense probably null
IGL02380:Grm4 APN 17 27,653,635 (GRCm39) missense probably damaging 1.00
IGL03244:Grm4 APN 17 27,653,797 (GRCm39) missense probably damaging 0.99
R0013:Grm4 UTSW 17 27,650,549 (GRCm39) missense probably benign 0.01
R0352:Grm4 UTSW 17 27,670,865 (GRCm39) splice site probably benign
R0599:Grm4 UTSW 17 27,650,464 (GRCm39) missense probably benign 0.39
R0616:Grm4 UTSW 17 27,653,538 (GRCm39) missense probably damaging 1.00
R0645:Grm4 UTSW 17 27,654,183 (GRCm39) missense probably damaging 1.00
R0726:Grm4 UTSW 17 27,657,412 (GRCm39) splice site probably benign
R1085:Grm4 UTSW 17 27,692,007 (GRCm39) missense probably damaging 1.00
R1486:Grm4 UTSW 17 27,653,691 (GRCm39) missense probably damaging 1.00
R1535:Grm4 UTSW 17 27,653,775 (GRCm39) missense probably benign 0.01
R1799:Grm4 UTSW 17 27,691,914 (GRCm39) missense probably damaging 0.99
R1914:Grm4 UTSW 17 27,653,686 (GRCm39) missense probably damaging 0.99
R2472:Grm4 UTSW 17 27,653,649 (GRCm39) missense probably damaging 1.00
R3759:Grm4 UTSW 17 27,654,273 (GRCm39) missense probably benign 0.00
R4244:Grm4 UTSW 17 27,721,709 (GRCm39) missense probably damaging 1.00
R5390:Grm4 UTSW 17 27,653,712 (GRCm39) missense probably damaging 1.00
R5476:Grm4 UTSW 17 27,653,772 (GRCm39) missense probably benign 0.04
R5516:Grm4 UTSW 17 27,657,385 (GRCm39) missense probably benign 0.06
R5897:Grm4 UTSW 17 27,654,137 (GRCm39) missense probably benign 0.02
R5956:Grm4 UTSW 17 27,654,129 (GRCm39) missense probably benign 0.01
R6391:Grm4 UTSW 17 27,654,294 (GRCm39) missense probably benign 0.00
R7330:Grm4 UTSW 17 27,653,798 (GRCm39) nonsense probably null
R7449:Grm4 UTSW 17 27,654,345 (GRCm39) missense probably damaging 1.00
R8338:Grm4 UTSW 17 27,653,977 (GRCm39) missense probably damaging 1.00
R8734:Grm4 UTSW 17 27,657,765 (GRCm39) missense probably damaging 1.00
R8899:Grm4 UTSW 17 27,653,754 (GRCm39) missense probably damaging 1.00
R9157:Grm4 UTSW 17 27,653,956 (GRCm39) missense probably benign 0.21
R9203:Grm4 UTSW 17 27,653,980 (GRCm39) missense probably benign 0.04
R9267:Grm4 UTSW 17 27,654,183 (GRCm39) missense possibly damaging 0.86
R9292:Grm4 UTSW 17 27,692,037 (GRCm39) missense probably damaging 1.00
R9578:Grm4 UTSW 17 27,669,183 (GRCm39) missense possibly damaging 0.56
R9746:Grm4 UTSW 17 27,657,765 (GRCm39) missense probably damaging 1.00
R9762:Grm4 UTSW 17 27,721,688 (GRCm39) missense probably damaging 1.00
Z1177:Grm4 UTSW 17 27,669,195 (GRCm39) missense probably benign 0.12
Z1177:Grm4 UTSW 17 27,669,168 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGTACATGGTGAAGCCG -3'
(R):5'- TTCCTCATGATCGCAGAGCC -3'

Sequencing Primer
(F):5'- TGTACATGGTGAAGCCGATGGG -3'
(R):5'- ATCTACCGCATCTTTGAGCAGGG -3'
Posted On 2022-04-18