Incidental Mutation 'R9344:Aldh1a1'
ID 707712
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Name aldehyde dehydrogenase family 1, subfamily A1
Synonyms Ahd-2, Ahd2, ALDH1, E1, Raldh1
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R9344 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20470079-20620829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20608150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 324 (V324D)
Ref Sequence ENSEMBL: ENSMUSP00000084918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638]
AlphaFold P24549
Predicted Effect probably damaging
Transcript: ENSMUST00000087638
AA Change: V324D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279
AA Change: V324D

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Irs2 G T 8: 11,057,289 (GRCm39) S381* probably null Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20,597,361 (GRCm39) missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20,620,283 (GRCm39) missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20,614,028 (GRCm39) splice site probably benign
IGL02989:Aldh1a1 APN 19 20,617,422 (GRCm39) splice site probably benign
IGL03154:Aldh1a1 APN 19 20,608,132 (GRCm39) missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20,604,010 (GRCm39) intron probably benign
R0265:Aldh1a1 UTSW 19 20,617,440 (GRCm39) nonsense probably null
R0282:Aldh1a1 UTSW 19 20,606,413 (GRCm39) splice site probably benign
R0418:Aldh1a1 UTSW 19 20,606,413 (GRCm39) splice site probably benign
R0471:Aldh1a1 UTSW 19 20,579,377 (GRCm39) start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20,611,842 (GRCm39) missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20,595,358 (GRCm39) missense probably benign
R1164:Aldh1a1 UTSW 19 20,595,310 (GRCm39) missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20,608,182 (GRCm39) missense probably damaging 1.00
R1905:Aldh1a1 UTSW 19 20,595,362 (GRCm39) missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20,620,279 (GRCm39) missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20,597,455 (GRCm39) missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20,617,442 (GRCm39) missense probably benign
R3871:Aldh1a1 UTSW 19 20,602,117 (GRCm39) nonsense probably null
R4607:Aldh1a1 UTSW 19 20,599,051 (GRCm39) missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20,617,445 (GRCm39) missense probably benign
R4791:Aldh1a1 UTSW 19 20,597,349 (GRCm39) missense probably damaging 0.99
R4792:Aldh1a1 UTSW 19 20,597,349 (GRCm39) missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20,611,764 (GRCm39) missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20,600,786 (GRCm39) missense probably damaging 1.00
R5669:Aldh1a1 UTSW 19 20,588,284 (GRCm39) missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20,608,034 (GRCm39) missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20,595,323 (GRCm39) missense probably damaging 0.99
R7078:Aldh1a1 UTSW 19 20,579,434 (GRCm39) missense probably benign
R7282:Aldh1a1 UTSW 19 20,606,434 (GRCm39) missense possibly damaging 0.68
R7334:Aldh1a1 UTSW 19 20,599,075 (GRCm39) missense probably damaging 1.00
R7578:Aldh1a1 UTSW 19 20,595,366 (GRCm39) missense probably damaging 0.98
R7920:Aldh1a1 UTSW 19 20,595,301 (GRCm39) missense probably damaging 1.00
R8745:Aldh1a1 UTSW 19 20,611,807 (GRCm39) missense probably benign
R8854:Aldh1a1 UTSW 19 20,588,297 (GRCm39) nonsense probably null
R9556:Aldh1a1 UTSW 19 20,600,756 (GRCm39) missense possibly damaging 0.69
R9581:Aldh1a1 UTSW 19 20,597,417 (GRCm39) missense probably benign 0.43
R9638:Aldh1a1 UTSW 19 20,614,100 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACAAGTGTGAGTATGCGCAC -3'
(R):5'- CTGGTCAACACAAAACAGAATGAGTTC -3'

Sequencing Primer
(F):5'- GTGAGTATGCGCACACACATAC -3'
(R):5'- CTTGTATTGGAAATGATCGTCT -3'
Posted On 2022-04-18