Incidental Mutation 'R9345:Fryl'
ID 707730
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 9030227G01Rik, 2310004H21Rik, 2510002A14Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.740) question?
Stock # R9345 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 73177534-73414042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73207754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 2472 (C2472Y)
Ref Sequence ENSEMBL: ENSMUSP00000092289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: C2472Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: C2472Y

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: C2472Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: C2472Y

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,807,869 (GRCm39) I837F probably damaging Het
Acot3 A G 12: 84,103,866 (GRCm39) Y225C probably benign Het
Adam17 A G 12: 21,378,056 (GRCm39) V710A probably damaging Het
Ank3 A G 10: 69,761,899 (GRCm39) probably benign Het
Ankrd60 T A 2: 173,410,610 (GRCm39) K303N possibly damaging Het
Atp10b T A 11: 43,094,024 (GRCm39) S523T probably damaging Het
Bptf A G 11: 106,971,588 (GRCm39) V973A possibly damaging Het
Ccdc24 C T 4: 117,729,691 (GRCm39) W9* probably null Het
Ccdc82 A G 9: 13,281,891 (GRCm39) T439A probably benign Het
Ccne2 C A 4: 11,199,420 (GRCm39) Q274K probably benign Het
Clec11a T C 7: 43,956,189 (GRCm39) M1V probably null Het
Col12a1 T A 9: 79,541,017 (GRCm39) Y2370F probably benign Het
Cyp4a32 C T 4: 115,467,699 (GRCm39) H228Y probably benign Het
Dchs2 G A 3: 83,036,101 (GRCm39) G283S probably benign Het
Dis3 T C 14: 99,318,814 (GRCm39) T659A probably damaging Het
Dock5 T C 14: 68,060,071 (GRCm39) D456G possibly damaging Het
Efr3b T A 12: 4,033,409 (GRCm39) K249* probably null Het
Emilin2 C T 17: 71,581,539 (GRCm39) V396I probably benign Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fasn A T 11: 120,706,735 (GRCm39) S947T probably benign Het
Gm3159 A T 14: 4,398,488 (GRCm38) I60L probably benign Het
Gm3402 A T 5: 146,451,330 (GRCm39) N63Y probably damaging Het
Gm49355 C T 14: 12,296,641 (GRCm38) probably benign Het
Grm2 A G 9: 106,528,287 (GRCm39) L199P probably damaging Het
Hck T A 2: 152,992,904 (GRCm39) H470Q probably benign Het
Hsd17b4 T C 18: 50,299,981 (GRCm39) Y413H probably benign Het
Ice1 A G 13: 70,740,758 (GRCm39) F80L Het
Ifrd1 G A 12: 40,267,458 (GRCm39) P38S possibly damaging Het
Itgad A G 7: 127,788,479 (GRCm39) T431A probably benign Het
Kcnd3 A T 3: 105,566,003 (GRCm39) I395F probably damaging Het
Kif20a A G 18: 34,759,779 (GRCm39) E58G probably benign Het
Kras A T 6: 145,192,442 (GRCm39) D30E probably benign Het
Lmbrd1 C T 1: 24,724,593 (GRCm39) A59V probably damaging Het
Lrrc20 T C 10: 61,383,890 (GRCm39) L99P probably damaging Het
Mfn2 T C 4: 147,966,649 (GRCm39) D514G probably benign Het
Myl2 A G 5: 122,242,902 (GRCm39) E96G probably damaging Het
Nppb T G 4: 148,070,518 (GRCm39) L29R probably damaging Het
Or51f1e C T 7: 102,747,713 (GRCm39) A255V possibly damaging Het
Or5ak22 A G 2: 85,230,097 (GRCm39) V260A probably benign Het
Pcdhb14 A G 18: 37,581,281 (GRCm39) H129R probably damaging Het
Pex11g T C 8: 3,509,363 (GRCm39) N188S possibly damaging Het
Pla2g3 A G 11: 3,442,170 (GRCm39) D410G probably benign Het
Pnma1 C A 12: 84,194,232 (GRCm39) W157L probably benign Het
Pofut2 A G 10: 77,103,090 (GRCm39) Y362C probably damaging Het
Ppp1r14c C A 10: 3,373,567 (GRCm39) S126* probably null Het
Psg27 T C 7: 18,299,081 (GRCm39) H80R probably benign Het
Rere T A 4: 150,554,770 (GRCm39) V156D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Samd8 G A 14: 21,830,227 (GRCm39) V281I probably benign Het
Scarf1 A G 11: 75,404,401 (GRCm39) probably benign Het
Scgb2b27 A G 7: 33,712,722 (GRCm39) L40P probably benign Het
Sdk1 A T 5: 142,147,708 (GRCm39) H1780L probably benign Het
Slc10a6 T C 5: 103,754,521 (GRCm39) T337A probably benign Het
Slc44a4 A T 17: 35,140,219 (GRCm39) D208V probably benign Het
Slco1c1 G T 6: 141,493,553 (GRCm39) C363F probably benign Het
Smg5 T A 3: 88,261,848 (GRCm39) L707Q probably damaging Het
Supt5 A T 7: 28,016,412 (GRCm39) D789E probably benign Het
Tbcd A G 11: 121,464,648 (GRCm39) Y561C probably damaging Het
Tectb T C 19: 55,183,097 (GRCm39) L316P probably benign Het
Thrsp T C 7: 97,066,326 (GRCm39) T129A possibly damaging Het
Tnpo3 T C 6: 29,558,851 (GRCm39) H693R probably benign Het
Trim54 T G 5: 31,294,478 (GRCm39) D335E probably benign Het
Tsr1 A G 11: 74,790,126 (GRCm39) D107G probably benign Het
Ttc41 A T 10: 86,595,089 (GRCm39) E954D probably damaging Het
Ttn A G 2: 76,538,595 (GRCm39) L34701P possibly damaging Het
Vmn1r119 A C 7: 20,746,034 (GRCm39) V116G probably damaging Het
Vmn1r219 G A 13: 23,346,769 (GRCm39) probably benign Het
Zc3h12c T A 9: 52,028,010 (GRCm39) M470L probably benign Het
Zmynd8 T C 2: 165,654,668 (GRCm39) K615E possibly damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73,305,451 (GRCm39) missense possibly damaging 0.92
IGL01518:Fryl APN 5 73,244,305 (GRCm39) missense possibly damaging 0.76
IGL01545:Fryl APN 5 73,211,940 (GRCm39) missense probably damaging 1.00
IGL01646:Fryl APN 5 73,179,844 (GRCm39) critical splice donor site probably null
IGL01938:Fryl APN 5 73,279,707 (GRCm39) missense probably damaging 0.98
IGL01962:Fryl APN 5 73,190,134 (GRCm39) missense possibly damaging 0.62
IGL02064:Fryl APN 5 73,282,112 (GRCm39) unclassified probably benign
IGL02148:Fryl APN 5 73,233,302 (GRCm39) missense probably benign 0.35
IGL02418:Fryl APN 5 73,267,519 (GRCm39) splice site probably benign
IGL02431:Fryl APN 5 73,255,651 (GRCm39) missense probably benign 0.02
IGL02513:Fryl APN 5 73,222,636 (GRCm39) missense probably damaging 1.00
IGL02557:Fryl APN 5 73,255,736 (GRCm39) missense probably damaging 1.00
IGL02625:Fryl APN 5 73,227,220 (GRCm39) intron probably benign
IGL02642:Fryl APN 5 73,252,809 (GRCm39) missense probably benign
IGL02657:Fryl APN 5 73,212,203 (GRCm39) missense probably benign 0.01
IGL02706:Fryl APN 5 73,250,506 (GRCm39) missense probably benign 0.45
IGL03022:Fryl APN 5 73,216,726 (GRCm39) missense possibly damaging 0.82
IGL03144:Fryl APN 5 73,258,798 (GRCm39) missense probably null 0.22
IGL03155:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03183:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03275:Fryl APN 5 73,305,376 (GRCm39) missense possibly damaging 0.47
IGL03310:Fryl APN 5 73,293,659 (GRCm39) splice site probably benign
IGL03341:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03343:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03350:Fryl APN 5 73,290,649 (GRCm39) missense probably damaging 0.99
IGL03357:Fryl APN 5 73,211,402 (GRCm39) missense probably damaging 1.00
IGL03374:Fryl APN 5 73,267,624 (GRCm39) splice site probably benign
IGL03375:Fryl APN 5 73,245,792 (GRCm39) missense possibly damaging 0.91
bedeviled UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
Besotted UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0308:Fryl UTSW 5 73,198,947 (GRCm39) splice site probably benign
R0312:Fryl UTSW 5 73,230,231 (GRCm39) missense probably damaging 1.00
R0415:Fryl UTSW 5 73,255,757 (GRCm39) missense probably damaging 0.99
R0440:Fryl UTSW 5 73,244,315 (GRCm39) missense possibly damaging 0.91
R0446:Fryl UTSW 5 73,254,760 (GRCm39) missense possibly damaging 0.91
R0566:Fryl UTSW 5 73,221,840 (GRCm39) splice site probably benign
R0567:Fryl UTSW 5 73,222,734 (GRCm39) missense possibly damaging 0.50
R0606:Fryl UTSW 5 73,282,077 (GRCm39) missense probably benign 0.15
R0619:Fryl UTSW 5 73,226,074 (GRCm39) missense probably benign 0.22
R0654:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0658:Fryl UTSW 5 73,222,702 (GRCm39) missense probably damaging 1.00
R0707:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0744:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0745:Fryl UTSW 5 73,228,469 (GRCm39) missense probably damaging 0.96
R0833:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0885:Fryl UTSW 5 73,246,539 (GRCm39) missense probably damaging 0.97
R0894:Fryl UTSW 5 73,198,675 (GRCm39) splice site probably benign
R1076:Fryl UTSW 5 73,282,016 (GRCm39) unclassified probably benign
R1241:Fryl UTSW 5 73,267,614 (GRCm39) missense probably damaging 1.00
R1241:Fryl UTSW 5 73,222,268 (GRCm39) splice site probably benign
R1394:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1395:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1608:Fryl UTSW 5 73,232,094 (GRCm39) nonsense probably null
R1664:Fryl UTSW 5 73,216,778 (GRCm39) missense probably damaging 1.00
R1745:Fryl UTSW 5 73,190,204 (GRCm39) splice site probably benign
R1937:Fryl UTSW 5 73,290,710 (GRCm39) missense probably damaging 1.00
R1969:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R1993:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R1994:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R2029:Fryl UTSW 5 73,179,465 (GRCm39) nonsense probably null
R2036:Fryl UTSW 5 73,265,305 (GRCm39) critical splice donor site probably null
R2036:Fryl UTSW 5 73,179,887 (GRCm39) missense probably benign
R2088:Fryl UTSW 5 73,222,804 (GRCm39) missense probably benign 0.02
R2105:Fryl UTSW 5 73,279,642 (GRCm39) missense probably benign
R2106:Fryl UTSW 5 73,255,674 (GRCm39) missense probably damaging 1.00
R2186:Fryl UTSW 5 73,222,318 (GRCm39) missense probably damaging 1.00
R2239:Fryl UTSW 5 73,265,890 (GRCm39) missense probably damaging 0.99
R2256:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2257:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2280:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2281:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2911:Fryl UTSW 5 73,207,799 (GRCm39) missense probably damaging 0.99
R3019:Fryl UTSW 5 73,240,193 (GRCm39) missense probably benign 0.01
R3416:Fryl UTSW 5 73,265,417 (GRCm39) missense possibly damaging 0.84
R3783:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3787:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3837:Fryl UTSW 5 73,228,608 (GRCm39) missense probably benign 0.03
R3969:Fryl UTSW 5 73,269,766 (GRCm39) missense probably damaging 0.97
R4387:Fryl UTSW 5 73,243,903 (GRCm39) missense possibly damaging 0.91
R4502:Fryl UTSW 5 73,245,740 (GRCm39) missense probably damaging 1.00
R4658:Fryl UTSW 5 73,238,396 (GRCm39) missense probably damaging 1.00
R4664:Fryl UTSW 5 73,248,022 (GRCm39) missense possibly damaging 0.80
R4690:Fryl UTSW 5 73,257,636 (GRCm39) missense probably benign
R4700:Fryl UTSW 5 73,222,881 (GRCm39) missense possibly damaging 0.88
R4709:Fryl UTSW 5 73,238,315 (GRCm39) missense probably benign 0.03
R4807:Fryl UTSW 5 73,198,705 (GRCm39) missense probably benign 0.00
R4912:Fryl UTSW 5 73,226,125 (GRCm39) frame shift probably null
R4948:Fryl UTSW 5 73,246,473 (GRCm39) missense probably benign 0.08
R4959:Fryl UTSW 5 73,192,401 (GRCm39) missense probably benign 0.00
R5062:Fryl UTSW 5 73,233,236 (GRCm39) missense possibly damaging 0.89
R5067:Fryl UTSW 5 73,215,098 (GRCm39) missense probably benign 0.13
R5071:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5072:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5073:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5074:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5139:Fryl UTSW 5 73,248,061 (GRCm39) missense probably damaging 1.00
R5172:Fryl UTSW 5 73,259,016 (GRCm39) missense possibly damaging 0.95
R5187:Fryl UTSW 5 73,243,943 (GRCm39) missense possibly damaging 0.95
R5272:Fryl UTSW 5 73,222,479 (GRCm39) nonsense probably null
R5275:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5295:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5344:Fryl UTSW 5 73,262,117 (GRCm39) missense probably damaging 1.00
R5355:Fryl UTSW 5 73,231,247 (GRCm39) missense probably damaging 1.00
R5716:Fryl UTSW 5 73,257,808 (GRCm39) missense probably benign
R5778:Fryl UTSW 5 73,230,121 (GRCm39) missense probably damaging 1.00
R5810:Fryl UTSW 5 73,248,098 (GRCm39) missense probably benign 0.06
R5934:Fryl UTSW 5 73,248,060 (GRCm39) missense probably damaging 1.00
R5948:Fryl UTSW 5 73,254,715 (GRCm39) critical splice donor site probably null
R6005:Fryl UTSW 5 73,240,638 (GRCm39) missense probably damaging 1.00
R6026:Fryl UTSW 5 73,257,340 (GRCm39) missense probably benign 0.04
R6045:Fryl UTSW 5 73,275,894 (GRCm39) missense probably damaging 0.99
R6185:Fryl UTSW 5 73,270,131 (GRCm39) missense probably benign 0.43
R6247:Fryl UTSW 5 73,222,824 (GRCm39) missense probably damaging 0.98
R6294:Fryl UTSW 5 73,349,102 (GRCm39) intron probably benign
R6310:Fryl UTSW 5 73,349,104 (GRCm39) intron probably benign
R6429:Fryl UTSW 5 73,248,094 (GRCm39) missense possibly damaging 0.84
R6568:Fryl UTSW 5 73,216,859 (GRCm39) missense probably damaging 1.00
R6636:Fryl UTSW 5 73,290,655 (GRCm39) missense probably benign 0.01
R6664:Fryl UTSW 5 73,289,824 (GRCm39) missense probably damaging 1.00
R6732:Fryl UTSW 5 73,212,124 (GRCm39) missense probably damaging 1.00
R6750:Fryl UTSW 5 73,179,575 (GRCm39) missense probably damaging 1.00
R6805:Fryl UTSW 5 73,222,437 (GRCm39) missense probably benign 0.03
R6823:Fryl UTSW 5 73,222,560 (GRCm39) missense probably damaging 0.99
R6855:Fryl UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
R6858:Fryl UTSW 5 73,222,375 (GRCm39) missense probably damaging 1.00
R6868:Fryl UTSW 5 73,226,146 (GRCm39) missense probably damaging 1.00
R6898:Fryl UTSW 5 73,179,485 (GRCm39) missense probably damaging 0.96
R6908:Fryl UTSW 5 73,179,554 (GRCm39) missense probably damaging 1.00
R6958:Fryl UTSW 5 73,231,272 (GRCm39) missense possibly damaging 0.89
R6980:Fryl UTSW 5 73,207,773 (GRCm39) missense probably benign 0.06
R7036:Fryl UTSW 5 73,212,951 (GRCm39) missense probably benign 0.03
R7065:Fryl UTSW 5 73,248,099 (GRCm39) missense probably damaging 0.96
R7097:Fryl UTSW 5 73,231,251 (GRCm39) missense probably benign 0.31
R7171:Fryl UTSW 5 73,279,653 (GRCm39) missense probably damaging 0.97
R7191:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R7207:Fryl UTSW 5 73,222,438 (GRCm39) missense probably benign
R7236:Fryl UTSW 5 73,265,821 (GRCm39) missense possibly damaging 0.66
R7334:Fryl UTSW 5 73,204,839 (GRCm39) splice site probably null
R7425:Fryl UTSW 5 73,262,091 (GRCm39) missense probably damaging 1.00
R7452:Fryl UTSW 5 73,181,331 (GRCm39) missense probably damaging 1.00
R7479:Fryl UTSW 5 73,254,904 (GRCm39) missense possibly damaging 0.71
R7535:Fryl UTSW 5 73,255,539 (GRCm39) missense probably benign 0.15
R7538:Fryl UTSW 5 73,180,019 (GRCm39) missense probably benign 0.09
R7544:Fryl UTSW 5 73,238,382 (GRCm39) missense probably benign
R7548:Fryl UTSW 5 73,349,105 (GRCm39) missense unknown
R7565:Fryl UTSW 5 73,191,063 (GRCm39) missense probably benign 0.18
R7572:Fryl UTSW 5 73,245,739 (GRCm39) missense possibly damaging 0.91
R7582:Fryl UTSW 5 73,179,843 (GRCm39) critical splice donor site probably null
R7630:Fryl UTSW 5 73,267,588 (GRCm39) missense possibly damaging 0.62
R7774:Fryl UTSW 5 73,240,727 (GRCm39) missense probably benign 0.12
R7777:Fryl UTSW 5 73,228,641 (GRCm39) missense probably damaging 0.98
R7917:Fryl UTSW 5 73,211,875 (GRCm39) missense probably damaging 1.00
R7920:Fryl UTSW 5 73,259,150 (GRCm39) splice site probably null
R8110:Fryl UTSW 5 73,290,620 (GRCm39) missense probably benign 0.10
R8120:Fryl UTSW 5 73,228,527 (GRCm39) missense probably benign 0.01
R8143:Fryl UTSW 5 73,207,682 (GRCm39) missense probably benign 0.00
R8207:Fryl UTSW 5 73,257,843 (GRCm39) splice site probably null
R8263:Fryl UTSW 5 73,238,348 (GRCm39) missense probably damaging 1.00
R8350:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8359:Fryl UTSW 5 73,233,276 (GRCm39) missense probably benign 0.39
R8387:Fryl UTSW 5 73,293,663 (GRCm39) critical splice donor site probably null
R8403:Fryl UTSW 5 73,275,790 (GRCm39) makesense probably null
R8450:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8514:Fryl UTSW 5 73,242,699 (GRCm39) missense probably benign
R8536:Fryl UTSW 5 73,257,696 (GRCm39) missense probably damaging 0.99
R8703:Fryl UTSW 5 73,247,997 (GRCm39) missense probably damaging 0.99
R8708:Fryl UTSW 5 73,289,905 (GRCm39) missense probably benign 0.01
R8783:Fryl UTSW 5 73,226,185 (GRCm39) missense probably benign 0.45
R9028:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R9045:Fryl UTSW 5 73,182,118 (GRCm39) missense
R9063:Fryl UTSW 5 73,238,346 (GRCm39) missense possibly damaging 0.70
R9096:Fryl UTSW 5 73,265,920 (GRCm39) missense probably benign 0.01
R9244:Fryl UTSW 5 73,348,862 (GRCm39) intron probably benign
R9381:Fryl UTSW 5 73,240,637 (GRCm39) missense probably benign 0.24
R9386:Fryl UTSW 5 73,349,152 (GRCm39) missense unknown
R9401:Fryl UTSW 5 73,222,563 (GRCm39) nonsense probably null
R9497:Fryl UTSW 5 73,215,134 (GRCm39) missense
R9514:Fryl UTSW 5 73,262,115 (GRCm39) missense probably damaging 1.00
R9570:Fryl UTSW 5 73,179,498 (GRCm39) missense probably benign 0.02
R9654:Fryl UTSW 5 73,275,801 (GRCm39) missense probably benign
R9665:Fryl UTSW 5 73,222,299 (GRCm39) missense probably damaging 1.00
R9685:Fryl UTSW 5 73,216,879 (GRCm39) missense probably damaging 0.99
R9798:Fryl UTSW 5 73,192,402 (GRCm39) missense probably benign
Z1088:Fryl UTSW 5 73,248,081 (GRCm39) missense probably damaging 1.00
Z1088:Fryl UTSW 5 73,248,052 (GRCm39) missense probably damaging 0.99
Z1176:Fryl UTSW 5 73,230,180 (GRCm39) missense probably benign
Z1177:Fryl UTSW 5 73,198,938 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGACCATCTGAAGGCATGAGG -3'
(R):5'- CTCTGCTTTTGAGAATGCATTCAG -3'

Sequencing Primer
(F):5'- GCTCGTCTACTTTGTGGAG -3'
(R):5'- CACCTTGGTATATGTTCCCGGG -3'
Posted On 2022-04-18