Incidental Mutation 'R9345:Ttc41'
ID 707756
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9345 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86759225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 954 (E954D)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: E954D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: E954D

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,819,430 I837F probably damaging Het
Acot3 A G 12: 84,057,092 Y225C probably benign Het
Adam17 A G 12: 21,328,055 V710A probably damaging Het
Ank3 A G 10: 69,926,069 probably benign Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Atp10b T A 11: 43,203,197 S523T probably damaging Het
Bptf A G 11: 107,080,762 V973A possibly damaging Het
Ccdc24 C T 4: 117,872,494 W9* probably null Het
Ccdc82 A G 9: 13,281,401 T439A probably benign Het
Ccne2 C A 4: 11,199,420 Q274K probably benign Het
Clec11a T C 7: 44,306,765 M1V probably null Het
Col12a1 T A 9: 79,633,735 Y2370F probably benign Het
Cyp4a32 C T 4: 115,610,502 H228Y probably benign Het
Dchs2 G A 3: 83,128,794 G283S probably benign Het
Dis3 T C 14: 99,081,378 T659A probably damaging Het
Dock5 T C 14: 67,822,622 D456G possibly damaging Het
Efr3b T A 12: 3,983,409 K249* probably null Het
Emilin2 C T 17: 71,274,544 V396I probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fasn A T 11: 120,815,909 S947T probably benign Het
Fryl C T 5: 73,050,411 C2472Y probably benign Het
Gm3159 A T 14: 4,398,488 I60L probably benign Het
Gm3402 A T 5: 146,514,520 N63Y probably damaging Het
Gm49355 C T 14: 12,296,641 probably benign Het
Grm2 A G 9: 106,651,088 L199P probably damaging Het
Hck T A 2: 153,150,984 H470Q probably benign Het
Hsd17b4 T C 18: 50,166,914 Y413H probably benign Het
Ice1 A G 13: 70,592,639 F80L Het
Ifrd1 G A 12: 40,217,459 P38S possibly damaging Het
Itgad A G 7: 128,189,307 T431A probably benign Het
Kcnd3 A T 3: 105,658,687 I395F probably damaging Het
Kif20a A G 18: 34,626,726 E58G probably benign Het
Kras A T 6: 145,246,716 D30E probably benign Het
Lmbrd1 C T 1: 24,685,512 A59V probably damaging Het
Lrrc20 T C 10: 61,548,111 L99P probably damaging Het
Mfn2 T C 4: 147,882,192 D514G probably benign Het
Myl2 A G 5: 122,104,839 E96G probably damaging Het
Nppb T G 4: 147,986,061 L29R probably damaging Het
Olfr585 C T 7: 103,098,506 A255V possibly damaging Het
Olfr992 A G 2: 85,399,753 V260A probably benign Het
Pcdhb14 A G 18: 37,448,228 H129R probably damaging Het
Pex11g T C 8: 3,459,363 N188S possibly damaging Het
Pla2g3 A G 11: 3,492,170 D410G probably benign Het
Pnma1 C A 12: 84,147,458 W157L probably benign Het
Pofut2 A G 10: 77,267,256 Y362C probably damaging Het
Ppp1r14c C A 10: 3,423,567 S126* probably null Het
Psg27 T C 7: 18,565,156 H80R probably benign Het
Rere T A 4: 150,470,313 V156D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Samd8 G A 14: 21,780,159 V281I probably benign Het
Scarf1 A G 11: 75,513,575 probably benign Het
Scgb2b27 A G 7: 34,013,297 L40P probably benign Het
Sdk1 A T 5: 142,161,953 H1780L probably benign Het
Slc10a6 T C 5: 103,606,655 T337A probably benign Het
Slc44a4 A T 17: 34,921,243 D208V probably benign Het
Slco1c1 G T 6: 141,547,827 C363F probably benign Het
Smg5 T A 3: 88,354,541 L707Q probably damaging Het
Supt5 A T 7: 28,316,987 D789E probably benign Het
Tbcd A G 11: 121,573,822 Y561C probably damaging Het
Tectb T C 19: 55,194,665 L316P probably benign Het
Thrsp T C 7: 97,417,119 T129A possibly damaging Het
Tnpo3 T C 6: 29,558,852 H693R probably benign Het
Trim54 T G 5: 31,137,134 D335E probably benign Het
Tsr1 A G 11: 74,899,300 D107G probably benign Het
Ttn A G 2: 76,708,251 L34701P possibly damaging Het
Vmn1r119 A C 7: 21,012,109 V116G probably damaging Het
Vmn1r219 G A 13: 23,162,599 probably benign Het
Zc3h12c T A 9: 52,116,710 M470L probably benign Het
Zmynd8 T C 2: 165,812,748 K615E possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGGGGATAAACAAAGCCTTAAG -3'
(R):5'- ACCAATGAGTTATGTGGGAGATGTG -3'

Sequencing Primer
(F):5'- CAAAGCCTTAAGTGTTATGTTCTTTG -3'
(R):5'- TCTACCTTCCAAGTGCAGGGATG -3'
Posted On 2022-04-18