Incidental Mutation 'R0743:Olfr610'
ID70776
Institutional Source Beutler Lab
Gene Symbol Olfr610
Ensembl Gene ENSMUSG00000045584
Gene Nameolfactory receptor 610
SynonymsMOR9-2, GA_x6K02T2PBJ9-6221839-6220892
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103505375-103512122 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 103506862 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 28 (W28*)
Ref Sequence ENSEMBL: ENSMUSP00000150921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063109] [ENSMUST00000217627]
Predicted Effect probably null
Transcript: ENSMUST00000063109
AA Change: W28*
SMART Domains Protein: ENSMUSP00000052577
Gene: ENSMUSG00000045584
AA Change: W28*

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.5e-106 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.9e-10 PFAM
Pfam:7tm_1 43 295 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213422
Predicted Effect probably null
Transcript: ENSMUST00000217627
AA Change: W28*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Olfr610
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Olfr610 APN 7 103506796 missense possibly damaging 0.67
IGL02179:Olfr610 APN 7 103506727 missense probably damaging 1.00
IGL02303:Olfr610 APN 7 103506088 missense probably benign 0.05
IGL02507:Olfr610 APN 7 103506718 nonsense probably null
IGL02562:Olfr610 APN 7 103506216 nonsense probably null
IGL02806:Olfr610 APN 7 103506003 missense probably benign 0.10
R0884:Olfr610 UTSW 7 103506862 nonsense probably null
R1673:Olfr610 UTSW 7 103506689 missense probably damaging 0.99
R1752:Olfr610 UTSW 7 103506558 missense probably benign 0.02
R1800:Olfr610 UTSW 7 103506041 missense possibly damaging 0.89
R2043:Olfr610 UTSW 7 103506943 start codon destroyed probably null 0.98
R2254:Olfr610 UTSW 7 103506064 missense probably damaging 1.00
R2566:Olfr610 UTSW 7 103506160 missense probably benign 0.08
R4433:Olfr610 UTSW 7 103506139 missense probably benign 0.04
R5206:Olfr610 UTSW 7 103506102 nonsense probably null
R5470:Olfr610 UTSW 7 103506509 missense probably benign 0.00
R6020:Olfr610 UTSW 7 103506799 missense probably benign
R6848:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7222:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7832:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7837:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7893:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
R7915:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7920:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7976:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAGAGAACGGCTGACTCGATGAC -3'
(R):5'- TGGCAATGCCACAGAGATATCATGC -3'

Sequencing Primer
(F):5'- CTGACTCGATGACTGAAAATGTGTG -3'
(R):5'- CCACAGAGATATCATGCAAGAAG -3'
Posted On2013-09-30