Incidental Mutation 'R9345:Ice1'
ID 707770
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock # R9345 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70592639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 80 (F80L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: F2150L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: F2150L

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,819,430 I837F probably damaging Het
Acot3 A G 12: 84,057,092 Y225C probably benign Het
Adam17 A G 12: 21,328,055 V710A probably damaging Het
Ank3 A G 10: 69,926,069 probably benign Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Atp10b T A 11: 43,203,197 S523T probably damaging Het
Bptf A G 11: 107,080,762 V973A possibly damaging Het
Ccdc24 C T 4: 117,872,494 W9* probably null Het
Ccdc82 A G 9: 13,281,401 T439A probably benign Het
Ccne2 C A 4: 11,199,420 Q274K probably benign Het
Clec11a T C 7: 44,306,765 M1V probably null Het
Col12a1 T A 9: 79,633,735 Y2370F probably benign Het
Cyp4a32 C T 4: 115,610,502 H228Y probably benign Het
Dchs2 G A 3: 83,128,794 G283S probably benign Het
Dis3 T C 14: 99,081,378 T659A probably damaging Het
Dock5 T C 14: 67,822,622 D456G possibly damaging Het
Efr3b T A 12: 3,983,409 K249* probably null Het
Emilin2 C T 17: 71,274,544 V396I probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fasn A T 11: 120,815,909 S947T probably benign Het
Fryl C T 5: 73,050,411 C2472Y probably benign Het
Gm3159 A T 14: 4,398,488 I60L probably benign Het
Gm3402 A T 5: 146,514,520 N63Y probably damaging Het
Gm49355 C T 14: 12,296,641 probably benign Het
Grm2 A G 9: 106,651,088 L199P probably damaging Het
Hck T A 2: 153,150,984 H470Q probably benign Het
Hsd17b4 T C 18: 50,166,914 Y413H probably benign Het
Ifrd1 G A 12: 40,217,459 P38S possibly damaging Het
Itgad A G 7: 128,189,307 T431A probably benign Het
Kcnd3 A T 3: 105,658,687 I395F probably damaging Het
Kif20a A G 18: 34,626,726 E58G probably benign Het
Kras A T 6: 145,246,716 D30E probably benign Het
Lmbrd1 C T 1: 24,685,512 A59V probably damaging Het
Lrrc20 T C 10: 61,548,111 L99P probably damaging Het
Mfn2 T C 4: 147,882,192 D514G probably benign Het
Myl2 A G 5: 122,104,839 E96G probably damaging Het
Nppb T G 4: 147,986,061 L29R probably damaging Het
Olfr585 C T 7: 103,098,506 A255V possibly damaging Het
Olfr992 A G 2: 85,399,753 V260A probably benign Het
Pcdhb14 A G 18: 37,448,228 H129R probably damaging Het
Pex11g T C 8: 3,459,363 N188S possibly damaging Het
Pla2g3 A G 11: 3,492,170 D410G probably benign Het
Pnma1 C A 12: 84,147,458 W157L probably benign Het
Pofut2 A G 10: 77,267,256 Y362C probably damaging Het
Ppp1r14c C A 10: 3,423,567 S126* probably null Het
Psg27 T C 7: 18,565,156 H80R probably benign Het
Rere T A 4: 150,470,313 V156D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Samd8 G A 14: 21,780,159 V281I probably benign Het
Scarf1 A G 11: 75,513,575 probably benign Het
Scgb2b27 A G 7: 34,013,297 L40P probably benign Het
Sdk1 A T 5: 142,161,953 H1780L probably benign Het
Slc10a6 T C 5: 103,606,655 T337A probably benign Het
Slc44a4 A T 17: 34,921,243 D208V probably benign Het
Slco1c1 G T 6: 141,547,827 C363F probably benign Het
Smg5 T A 3: 88,354,541 L707Q probably damaging Het
Supt5 A T 7: 28,316,987 D789E probably benign Het
Tbcd A G 11: 121,573,822 Y561C probably damaging Het
Tectb T C 19: 55,194,665 L316P probably benign Het
Thrsp T C 7: 97,417,119 T129A possibly damaging Het
Tnpo3 T C 6: 29,558,852 H693R probably benign Het
Trim54 T G 5: 31,137,134 D335E probably benign Het
Tsr1 A G 11: 74,899,300 D107G probably benign Het
Ttc41 A T 10: 86,759,225 E954D probably damaging Het
Ttn A G 2: 76,708,251 L34701P possibly damaging Het
Vmn1r119 A C 7: 21,012,109 V116G probably damaging Het
Vmn1r219 G A 13: 23,162,599 probably benign Het
Zc3h12c T A 9: 52,116,710 M470L probably benign Het
Zmynd8 T C 2: 165,812,748 K615E possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
R9452:Ice1 UTSW 13 70596343 missense probably damaging 1.00
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTGACCCTTGAAGATAC -3'
(R):5'- AGCTGTCTCACTGAGTGGTAG -3'

Sequencing Primer
(F):5'- GCAACTGACCCTTGAAGATACAACAC -3'
(R):5'- TGGTAGCCCACACTGCAC -3'
Posted On 2022-04-18