Incidental Mutation 'R9345:Abcc2'
ID 707782
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9345 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43819430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 837 (I837F)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably damaging
Transcript: ENSMUST00000026208
AA Change: I837F

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: I837F

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot3 A G 12: 84,057,092 Y225C probably benign Het
Adam17 A G 12: 21,328,055 V710A probably damaging Het
Ank3 A G 10: 69,926,069 probably benign Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Atp10b T A 11: 43,203,197 S523T probably damaging Het
Bptf A G 11: 107,080,762 V973A possibly damaging Het
Ccdc24 C T 4: 117,872,494 W9* probably null Het
Ccdc82 A G 9: 13,281,401 T439A probably benign Het
Ccne2 C A 4: 11,199,420 Q274K probably benign Het
Clec11a T C 7: 44,306,765 M1V probably null Het
Col12a1 T A 9: 79,633,735 Y2370F probably benign Het
Cyp4a32 C T 4: 115,610,502 H228Y probably benign Het
Dchs2 G A 3: 83,128,794 G283S probably benign Het
Dis3 T C 14: 99,081,378 T659A probably damaging Het
Dock5 T C 14: 67,822,622 D456G possibly damaging Het
Efr3b T A 12: 3,983,409 K249* probably null Het
Emilin2 C T 17: 71,274,544 V396I probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fasn A T 11: 120,815,909 S947T probably benign Het
Fryl C T 5: 73,050,411 C2472Y probably benign Het
Gm3159 A T 14: 4,398,488 I60L probably benign Het
Gm3402 A T 5: 146,514,520 N63Y probably damaging Het
Gm49355 C T 14: 12,296,641 probably benign Het
Grm2 A G 9: 106,651,088 L199P probably damaging Het
Hck T A 2: 153,150,984 H470Q probably benign Het
Hsd17b4 T C 18: 50,166,914 Y413H probably benign Het
Ice1 A G 13: 70,592,639 F80L Het
Ifrd1 G A 12: 40,217,459 P38S possibly damaging Het
Itgad A G 7: 128,189,307 T431A probably benign Het
Kcnd3 A T 3: 105,658,687 I395F probably damaging Het
Kif20a A G 18: 34,626,726 E58G probably benign Het
Kras A T 6: 145,246,716 D30E probably benign Het
Lmbrd1 C T 1: 24,685,512 A59V probably damaging Het
Lrrc20 T C 10: 61,548,111 L99P probably damaging Het
Mfn2 T C 4: 147,882,192 D514G probably benign Het
Myl2 A G 5: 122,104,839 E96G probably damaging Het
Nppb T G 4: 147,986,061 L29R probably damaging Het
Olfr585 C T 7: 103,098,506 A255V possibly damaging Het
Olfr992 A G 2: 85,399,753 V260A probably benign Het
Pcdhb14 A G 18: 37,448,228 H129R probably damaging Het
Pex11g T C 8: 3,459,363 N188S possibly damaging Het
Pla2g3 A G 11: 3,492,170 D410G probably benign Het
Pnma1 C A 12: 84,147,458 W157L probably benign Het
Pofut2 A G 10: 77,267,256 Y362C probably damaging Het
Ppp1r14c C A 10: 3,423,567 S126* probably null Het
Psg27 T C 7: 18,565,156 H80R probably benign Het
Rere T A 4: 150,470,313 V156D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Samd8 G A 14: 21,780,159 V281I probably benign Het
Scarf1 A G 11: 75,513,575 probably benign Het
Scgb2b27 A G 7: 34,013,297 L40P probably benign Het
Sdk1 A T 5: 142,161,953 H1780L probably benign Het
Slc10a6 T C 5: 103,606,655 T337A probably benign Het
Slc44a4 A T 17: 34,921,243 D208V probably benign Het
Slco1c1 G T 6: 141,547,827 C363F probably benign Het
Smg5 T A 3: 88,354,541 L707Q probably damaging Het
Supt5 A T 7: 28,316,987 D789E probably benign Het
Tbcd A G 11: 121,573,822 Y561C probably damaging Het
Tectb T C 19: 55,194,665 L316P probably benign Het
Thrsp T C 7: 97,417,119 T129A possibly damaging Het
Tnpo3 T C 6: 29,558,852 H693R probably benign Het
Trim54 T G 5: 31,137,134 D335E probably benign Het
Tsr1 A G 11: 74,899,300 D107G probably benign Het
Ttc41 A T 10: 86,759,225 E954D probably damaging Het
Ttn A G 2: 76,708,251 L34701P possibly damaging Het
Vmn1r119 A C 7: 21,012,109 V116G probably damaging Het
Vmn1r219 G A 13: 23,162,599 probably benign Het
Zc3h12c T A 9: 52,116,710 M470L probably benign Het
Zmynd8 T C 2: 165,812,748 K615E possibly damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8889:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43808662 missense probably benign 0.35
R9031:Abcc2 UTSW 19 43822027 missense probably benign
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTATCAGGATAGGCGCTG -3'
(R):5'- TGGGCAGTTCAGCTCCAAATG -3'

Sequencing Primer
(F):5'- CTATCAGGATAGGCGCTGGTCTAAG -3'
(R):5'- GGGCAGTTCAGCTCCAAATGTAATTC -3'
Posted On 2022-04-18