Incidental Mutation 'R9346:Dennd1a'
ID 707784
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene Name DENN/MADD domain containing 1A
Synonyms 6030446I19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock # R9346 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 37798991-38287390 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38021435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000130472] [ENSMUST00000140552] [ENSMUST00000150896]
AlphaFold Q8K382
Predicted Effect probably benign
Transcript: ENSMUST00000102787
AA Change: D180G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: D180G

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130472
SMART Domains Protein: ENSMUSP00000119892
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 64 4e-20 BLAST
PDB:3TW8|C 44 105 3e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Predicted Effect probably benign
Transcript: ENSMUST00000150896
SMART Domains Protein: ENSMUSP00000116723
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,288,269 C143F Het
Adam8 T C 7: 139,987,721 I370V probably benign Het
Adamts1 T A 16: 85,802,532 D60V possibly damaging Het
Adh5 G A 3: 138,451,442 V255I probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arid2 T C 15: 96,287,911 I37T probably benign Het
Arnt2 C T 7: 84,282,113 R383Q probably benign Het
Arrb1 T A 7: 99,593,000 Y238* probably null Het
Brdt T C 5: 107,377,014 I807T probably damaging Het
Cacna1d T A 14: 30,096,923 Q1247L possibly damaging Het
Carmil3 T C 14: 55,494,684 Y213H probably damaging Het
Ccdc180 A T 4: 45,927,953 T1163S probably benign Het
Cfl1 T A 19: 5,493,613 L206Q probably benign Het
Chga A G 12: 102,559,289 D63G probably damaging Het
Dopey2 T C 16: 93,780,814 probably null Het
Fam171a2 C T 11: 102,437,945 V663M possibly damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Gimap9 C A 6: 48,677,558 N26K probably damaging Het
Gtf2i A G 5: 134,244,809 F769L probably damaging Het
Gtf2i G T 5: 134,286,927 H164N probably benign Het
Ino80 G A 2: 119,426,958 T797I possibly damaging Het
Kcnma1 T C 14: 23,650,165 S188G possibly damaging Het
Krt82 A G 15: 101,550,524 M27T probably benign Het
Ncam2 A G 16: 81,455,316 K216E probably benign Het
Nynrin A G 14: 55,863,038 Q95R probably benign Het
Olfr1189 T A 2: 88,592,718 S305T probably benign Het
Olfr376 T C 11: 73,375,303 S188P probably benign Het
Pon1 C A 6: 5,193,722 V10L probably benign Het
Ptk2b T A 14: 66,178,092 N252Y possibly damaging Het
Rad51 G A 2: 119,118,612 C31Y probably benign Het
Sbf2 A G 7: 110,320,739 F1525L probably benign Het
Sec11a T C 7: 80,908,012 D173G unknown Het
Sftpd C T 14: 41,174,509 R239H probably benign Het
Shq1 T A 6: 100,664,470 Y150F probably damaging Het
Slc39a11 A G 11: 113,523,623 V50A probably damaging Het
Snrnp25 A T 11: 32,205,622 M1L probably benign Het
Tgm6 A T 2: 130,141,856 K312* probably null Het
Tln1 C A 4: 43,546,895 R827L probably damaging Het
Trim37 A T 11: 87,166,600 probably null Het
Zdhhc13 T A 7: 48,822,580 N495K probably benign Het
Zfp280b C T 10: 76,039,292 T335I possibly damaging Het
Zfp583 T A 7: 6,325,543 T16S probably benign Het
Zgpat C A 2: 181,380,051 D423E probably benign Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R0784:Dennd1a UTSW 2 38021414 missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38243390 splice site probably benign
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37852441 missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
R7408:Dennd1a UTSW 2 37852172 splice site probably null
R7446:Dennd1a UTSW 2 37816979 missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37858432 missense probably damaging 0.99
R7645:Dennd1a UTSW 2 38021363 missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37844829 missense probably benign
R8132:Dennd1a UTSW 2 37858060 missense probably damaging 1.00
R8305:Dennd1a UTSW 2 37858081 missense probably damaging 1.00
R8369:Dennd1a UTSW 2 38048754 missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37858391 missense probably benign 0.36
R8438:Dennd1a UTSW 2 37856138 missense probably benign 0.08
R8544:Dennd1a UTSW 2 37982908 splice site probably null
R8997:Dennd1a UTSW 2 37800485 missense probably benign 0.14
R9052:Dennd1a UTSW 2 38021451 missense probably damaging 1.00
R9087:Dennd1a UTSW 2 38021354 critical splice donor site probably null
R9096:Dennd1a UTSW 2 37800065 missense probably damaging 1.00
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Z1177:Dennd1a UTSW 2 37800257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTTGACACTGTAAAGG -3'
(R):5'- CTTCCAGGTAGAAAGTGTGGG -3'

Sequencing Primer
(F):5'- CTTTGACACTGTAAAGGGACATG -3'
(R):5'- GACAGGAAGAAGAGCACATGCC -3'
Posted On 2022-04-18