Mutagenetix > Incidental Mutation

Incidental Mutation 'R9346:Tln1'

707791

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9346 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43531519-43562691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43546895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 827 (R827L)

Ref Sequence

ENSEMBL: ENSMUSP00000030187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187]

AlphaFold

P26039

PDB Structure

Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<

Predicted Effect

probably damaging
Transcript: ENSMUST00000030187
AA Change: R827L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: R827L

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465
AA Change: R254L

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35\|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A\|A	215	279	1e-38	PDB

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465
AA Change: R56L

Domain	Start	End	E-Value	Type
PDB:1U89\|A	2	106	9e-50	PDB
low complexity region	107	120	N/A	INTRINSIC

Meta Mutation Damage Score

0.2394

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	T	11: 58,288,269	C143F		Het
Adam8	T	C	7: 139,987,721	I370V	probably benign	Het
Adamts1	T	A	16: 85,802,532	D60V	possibly damaging	Het
Adh5	G	A	3: 138,451,442	V255I	probably benign	Het
Aipl1	C	T	11: 72,037,427	G11D	probably damaging	Het
Arid2	T	C	15: 96,287,911	I37T	probably benign	Het
Arnt2	C	T	7: 84,282,113	R383Q	probably benign	Het
Arrb1	T	A	7: 99,593,000	Y238*	probably null	Het
Brdt	T	C	5: 107,377,014	I807T	probably damaging	Het
Cacna1d	T	A	14: 30,096,923	Q1247L	possibly damaging	Het
Carmil3	T	C	14: 55,494,684	Y213H	probably damaging	Het
Ccdc180	A	T	4: 45,927,953	T1163S	probably benign	Het
Cfl1	T	A	19: 5,493,613	L206Q	probably benign	Het
Chga	A	G	12: 102,559,289	D63G	probably damaging	Het
Dennd1a	T	C	2: 38,021,435	D180G	probably benign	Het
Dopey2	T	C	16: 93,780,814		probably null	Het
Fam171a2	C	T	11: 102,437,945	V663M	possibly damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Gimap9	C	A	6: 48,677,558	N26K	probably damaging	Het
Gtf2i	A	G	5: 134,244,809	F769L	probably damaging	Het
Gtf2i	G	T	5: 134,286,927	H164N	probably benign	Het
Ino80	G	A	2: 119,426,958	T797I	possibly damaging	Het
Kcnma1	T	C	14: 23,650,165	S188G	possibly damaging	Het
Krt82	A	G	15: 101,550,524	M27T	probably benign	Het
Ncam2	A	G	16: 81,455,316	K216E	probably benign	Het
Nynrin	A	G	14: 55,863,038	Q95R	probably benign	Het
Olfr1189	T	A	2: 88,592,718	S305T	probably benign	Het
Olfr376	T	C	11: 73,375,303	S188P	probably benign	Het
Pon1	C	A	6: 5,193,722	V10L	probably benign	Het
Ptk2b	T	A	14: 66,178,092	N252Y	possibly damaging	Het
Rad51	G	A	2: 119,118,612	C31Y	probably benign	Het
Sbf2	A	G	7: 110,320,739	F1525L	probably benign	Het
Sec11a	T	C	7: 80,908,012	D173G	unknown	Het
Sftpd	C	T	14: 41,174,509	R239H	probably benign	Het
Shq1	T	A	6: 100,664,470	Y150F	probably damaging	Het
Slc39a11	A	G	11: 113,523,623	V50A	probably damaging	Het
Snrnp25	A	T	11: 32,205,622	M1L	probably benign	Het
Tgm6	A	T	2: 130,141,856	K312*	probably null	Het
Trim37	A	T	11: 87,166,600		probably null	Het
Zdhhc13	T	A	7: 48,822,580	N495K	probably benign	Het
Zfp280b	C	T	10: 76,039,292	T335I	possibly damaging	Het
Zfp583	T	A	7: 6,325,543	T16S	probably benign	Het
Zgpat	C	A	2: 181,380,051	D423E	probably benign	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43542719	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43551297	unclassified	probably benign
IGL01345:Tln1	APN	4	43536281	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43543432	unclassified	probably benign
IGL01715:Tln1	APN	4	43555890	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43545435	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43539508	missense	probably benign
IGL01933:Tln1	APN	4	43555894	missense	possibly damaging	0.52
IGL02119:Tln1	APN	4	43546760	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43555388	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43546857	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43540612	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43539544	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43539522	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43555679	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43545694	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43532861	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43539084	splice site	probably benign
H8786:Tln1	UTSW	4	43544589	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43539998	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43542701	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0454:Tln1	UTSW	4	43553504	missense	probably benign
R0539:Tln1	UTSW	4	43543434	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43542709	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43550304	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43547756	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43553071	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43544645	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43555333	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43549825	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43538044	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43534578	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43536311	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43548005	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43545721	missense	probably benign
R2202:Tln1	UTSW	4	43553083	splice site	probably null
R2680:Tln1	UTSW	4	43539668	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43542525	missense	probably benign
R3714:Tln1	UTSW	4	43540597	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43549370	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43536295	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43536413	splice site	probably benign
R3983:Tln1	UTSW	4	43553030	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43549177	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43536104	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43543509	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43551018	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43533598	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43535954	missense	probably null	1.00
R4737:Tln1	UTSW	4	43540588	missense	probably benign	0.00
R4936:Tln1	UTSW	4	43547522	missense	possibly damaging	0.83
R5225:Tln1	UTSW	4	43539406	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43540661	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43533609	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43543905	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43547732	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43545191	missense	probably benign	0.13
R6012:Tln1	UTSW	4	43539508	missense	probably benign
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43538030	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43534744	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43533145	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43533866	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43543165	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43547525	missense	probably damaging	0.98
R6576:Tln1	UTSW	4	43555419	splice site	probably null
R6722:Tln1	UTSW	4	43547618	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43550217	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43556302	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43540616	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43542602	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43534399	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43545922	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43545206	missense	possibly damaging	0.80
R7836:Tln1	UTSW	4	43554309	missense	probably benign	0.01
R7874:Tln1	UTSW	4	43538041	missense	probably damaging	1.00
R7874:Tln1	UTSW	4	43555606	missense	probably damaging	1.00
R8030:Tln1	UTSW	4	43535737	critical splice donor site	probably null
R8105:Tln1	UTSW	4	43538231	missense	probably benign	0.32
R8212:Tln1	UTSW	4	43555918	missense	probably damaging	1.00
R8416:Tln1	UTSW	4	43540116	missense	probably benign	0.01
R8419:Tln1	UTSW	4	43536397	missense	probably damaging	1.00
R8680:Tln1	UTSW	4	43553041	missense	possibly damaging	0.52
R8708:Tln1	UTSW	4	43534769	splice site	probably benign
R8725:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8727:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8830:Tln1	UTSW	4	43556383	missense	probably benign
R8865:Tln1	UTSW	4	43538281	missense	possibly damaging	0.93
R9049:Tln1	UTSW	4	43549786	nonsense	probably null
R9050:Tln1	UTSW	4	43549786	nonsense	probably null
R9145:Tln1	UTSW	4	43536024	missense	probably damaging	1.00
R9210:Tln1	UTSW	4	43536119	missense	probably damaging	1.00
R9337:Tln1	UTSW	4	43532927	missense	probably damaging	1.00
R9358:Tln1	UTSW	4	43532084	missense	possibly damaging	0.68
R9487:Tln1	UTSW	4	43542893	missense	probably damaging	1.00
R9631:Tln1	UTSW	4	43545694	missense	probably damaging	1.00
R9650:Tln1	UTSW	4	43545912	missense	probably damaging	1.00
R9666:Tln1	UTSW	4	43542957	missense	probably damaging	0.96
RF021:Tln1	UTSW	4	43555890	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43533125	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43548015	nonsense	probably null
Z1176:Tln1	UTSW	4	43543211	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CCTTCAGGGTCTGTAGAGAAAC -3'
(R):5'- TAGCTGGAAACTGGCCCTTC -3'

Sequencing Primer
(F):5'- GAGAAACCGACTTTGTACCTTGGC -3'
(R):5'- ACCGGGAGATCTGTCCTGAGATC -3'

Posted On

2022-04-18