Incidental Mutation 'R9346:Brdt'
ID 707793
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Name bromodomain, testis-specific
Synonyms Fsrg3, 7420412D09Rik, Brd6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9346 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 107331159-107387058 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107377014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 807 (I807T)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
AlphaFold Q91Y44
PDB Structure Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031215
AA Change: I807T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: I807T

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,288,269 C143F Het
Adam8 T C 7: 139,987,721 I370V probably benign Het
Adamts1 T A 16: 85,802,532 D60V possibly damaging Het
Adh5 G A 3: 138,451,442 V255I probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Arid2 T C 15: 96,287,911 I37T probably benign Het
Arnt2 C T 7: 84,282,113 R383Q probably benign Het
Arrb1 T A 7: 99,593,000 Y238* probably null Het
Cacna1d T A 14: 30,096,923 Q1247L possibly damaging Het
Carmil3 T C 14: 55,494,684 Y213H probably damaging Het
Ccdc180 A T 4: 45,927,953 T1163S probably benign Het
Cfl1 T A 19: 5,493,613 L206Q probably benign Het
Chga A G 12: 102,559,289 D63G probably damaging Het
Dennd1a T C 2: 38,021,435 D180G probably benign Het
Dopey2 T C 16: 93,780,814 probably null Het
Fam171a2 C T 11: 102,437,945 V663M possibly damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Gimap9 C A 6: 48,677,558 N26K probably damaging Het
Gtf2i A G 5: 134,244,809 F769L probably damaging Het
Gtf2i G T 5: 134,286,927 H164N probably benign Het
Ino80 G A 2: 119,426,958 T797I possibly damaging Het
Kcnma1 T C 14: 23,650,165 S188G possibly damaging Het
Krt82 A G 15: 101,550,524 M27T probably benign Het
Ncam2 A G 16: 81,455,316 K216E probably benign Het
Nynrin A G 14: 55,863,038 Q95R probably benign Het
Olfr1189 T A 2: 88,592,718 S305T probably benign Het
Olfr376 T C 11: 73,375,303 S188P probably benign Het
Pon1 C A 6: 5,193,722 V10L probably benign Het
Ptk2b T A 14: 66,178,092 N252Y possibly damaging Het
Rad51 G A 2: 119,118,612 C31Y probably benign Het
Sbf2 A G 7: 110,320,739 F1525L probably benign Het
Sec11a T C 7: 80,908,012 D173G unknown Het
Sftpd C T 14: 41,174,509 R239H probably benign Het
Shq1 T A 6: 100,664,470 Y150F probably damaging Het
Slc39a11 A G 11: 113,523,623 V50A probably damaging Het
Snrnp25 A T 11: 32,205,622 M1L probably benign Het
Tgm6 A T 2: 130,141,856 K312* probably null Het
Tln1 C A 4: 43,546,895 R827L probably damaging Het
Trim37 A T 11: 87,166,600 probably null Het
Zdhhc13 T A 7: 48,822,580 N495K probably benign Het
Zfp280b C T 10: 76,039,292 T335I possibly damaging Het
Zfp583 T A 7: 6,325,543 T16S probably benign Het
Zgpat C A 2: 181,380,051 D423E probably benign Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 splice site probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R7972:Brdt UTSW 5 107348549 missense possibly damaging 0.53
R8064:Brdt UTSW 5 107377996 nonsense probably null
R8958:Brdt UTSW 5 107378011 missense probably benign
R9199:Brdt UTSW 5 107350163 nonsense probably null
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCACCCTGTTAACACGCAG -3'
(R):5'- CGCATTATGCTCCAGGTGTTTC -3'

Sequencing Primer
(F):5'- GAAACTGTCTAGAACCTTGGTGC -3'
(R):5'- AGGTGTTTCCGCATCTGC -3'
Posted On 2022-04-18