Incidental Mutation 'R9346:Aipl1'
ID 707809
Institutional Source Beutler Lab
Gene Symbol Aipl1
Ensembl Gene ENSMUSG00000040554
Gene Name aryl hydrocarbon receptor-interacting protein-like 1
Synonyms A930007I01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9346 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 71918789-71928335 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71928253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 11 (G11D)
Ref Sequence ENSEMBL: ENSMUSP00000036279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082] [ENSMUST00000122871]
AlphaFold Q924K1
Predicted Effect probably damaging
Transcript: ENSMUST00000048207
AA Change: G11D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: G11D

DomainStartEndE-ValueType
Pfam:FKBP_C 26 154 5.2e-8 PFAM
Pfam:TPR_2 178 210 4.6e-6 PFAM
low complexity region 240 251 N/A INTRINSIC
Pfam:TPR_2 264 296 5.5e-6 PFAM
low complexity region 302 312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059082
AA Change: G11D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554
AA Change: G11D

DomainStartEndE-ValueType
Pfam:FKBP_C 25 154 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122871
SMART Domains Protein: ENSMUSP00000123099
Gene: ENSMUSG00000020808

DomainStartEndE-ValueType
Pfam:DUF1466 1 77 1.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,179,095 (GRCm39) C143F Het
Adam8 T C 7: 139,567,634 (GRCm39) I370V probably benign Het
Adamts1 T A 16: 85,599,420 (GRCm39) D60V possibly damaging Het
Adh5 G A 3: 138,157,203 (GRCm39) V255I probably benign Het
Arid2 T C 15: 96,185,792 (GRCm39) I37T probably benign Het
Arnt2 C T 7: 83,931,321 (GRCm39) R383Q probably benign Het
Arrb1 T A 7: 99,242,207 (GRCm39) Y238* probably null Het
Brdt T C 5: 107,524,880 (GRCm39) I807T probably damaging Het
Cacna1d T A 14: 29,818,880 (GRCm39) Q1247L possibly damaging Het
Carmil3 T C 14: 55,732,141 (GRCm39) Y213H probably damaging Het
Ccdc180 A T 4: 45,927,953 (GRCm39) T1163S probably benign Het
Cfl1 T A 19: 5,543,641 (GRCm39) L206Q probably benign Het
Chga A G 12: 102,525,548 (GRCm39) D63G probably damaging Het
Dennd1a T C 2: 37,911,447 (GRCm39) D180G probably benign Het
Dop1b T C 16: 93,577,702 (GRCm39) probably null Het
Fam171a2 C T 11: 102,328,771 (GRCm39) V663M possibly damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Gimap9 C A 6: 48,654,492 (GRCm39) N26K probably damaging Het
Gtf2i A G 5: 134,273,663 (GRCm39) F769L probably damaging Het
Gtf2i G T 5: 134,315,781 (GRCm39) H164N probably benign Het
Ino80 G A 2: 119,257,439 (GRCm39) T797I possibly damaging Het
Kcnma1 T C 14: 23,700,233 (GRCm39) S188G possibly damaging Het
Krt82 A G 15: 101,458,959 (GRCm39) M27T probably benign Het
Ncam2 A G 16: 81,252,204 (GRCm39) K216E probably benign Het
Nynrin A G 14: 56,100,495 (GRCm39) Q95R probably benign Het
Or1e1c T C 11: 73,266,129 (GRCm39) S188P probably benign Het
Or4c102 T A 2: 88,423,062 (GRCm39) S305T probably benign Het
Pon1 C A 6: 5,193,722 (GRCm39) V10L probably benign Het
Ptk2b T A 14: 66,415,541 (GRCm39) N252Y possibly damaging Het
Rad51 G A 2: 118,949,093 (GRCm39) C31Y probably benign Het
Sbf2 A G 7: 109,919,946 (GRCm39) F1525L probably benign Het
Sec11a T C 7: 80,557,760 (GRCm39) D173G unknown Het
Sftpd C T 14: 40,896,466 (GRCm39) R239H probably benign Het
Shq1 T A 6: 100,641,431 (GRCm39) Y150F probably damaging Het
Slc39a11 A G 11: 113,414,449 (GRCm39) V50A probably damaging Het
Snrnp25 A T 11: 32,155,622 (GRCm39) M1L probably benign Het
Tgm6 A T 2: 129,983,776 (GRCm39) K312* probably null Het
Tln1 C A 4: 43,546,895 (GRCm39) R827L probably damaging Het
Trim37 A T 11: 87,057,426 (GRCm39) probably null Het
Zdhhc13 T A 7: 48,472,328 (GRCm39) N495K probably benign Het
Zfp280b C T 10: 75,875,126 (GRCm39) T335I possibly damaging Het
Zfp583 T A 7: 6,328,542 (GRCm39) T16S probably benign Het
Zgpat C A 2: 181,021,844 (GRCm39) D423E probably benign Het
Other mutations in Aipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Aipl1 APN 11 71,922,373 (GRCm39) missense probably damaging 1.00
IGL01713:Aipl1 APN 11 71,927,449 (GRCm39) missense probably damaging 1.00
IGL02031:Aipl1 APN 11 71,921,028 (GRCm39) utr 3 prime probably benign
IGL02603:Aipl1 APN 11 71,927,526 (GRCm39) missense possibly damaging 0.82
IGL02677:Aipl1 APN 11 71,920,222 (GRCm39) missense possibly damaging 0.90
R1563:Aipl1 UTSW 11 71,927,538 (GRCm39) missense probably damaging 0.99
R1835:Aipl1 UTSW 11 71,921,325 (GRCm39) missense possibly damaging 0.91
R2041:Aipl1 UTSW 11 71,922,332 (GRCm39) missense possibly damaging 0.87
R2118:Aipl1 UTSW 11 71,920,195 (GRCm39) missense possibly damaging 0.92
R2216:Aipl1 UTSW 11 71,922,272 (GRCm39) missense probably damaging 1.00
R4001:Aipl1 UTSW 11 71,922,428 (GRCm39) missense probably damaging 1.00
R4969:Aipl1 UTSW 11 71,922,256 (GRCm39) missense probably benign 0.22
R5428:Aipl1 UTSW 11 71,921,313 (GRCm39) missense probably benign 0.02
R5933:Aipl1 UTSW 11 71,921,108 (GRCm39) missense probably benign 0.01
R8151:Aipl1 UTSW 11 71,927,584 (GRCm39) missense probably benign 0.44
R8379:Aipl1 UTSW 11 71,920,126 (GRCm39) missense probably benign 0.05
R8406:Aipl1 UTSW 11 71,922,332 (GRCm39) missense possibly damaging 0.87
R8998:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R8999:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R9340:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9422:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9424:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9462:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9576:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9577:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9578:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9593:Aipl1 UTSW 11 71,921,161 (GRCm39) missense probably benign
X0018:Aipl1 UTSW 11 71,921,367 (GRCm39) missense probably benign 0.00
Z1176:Aipl1 UTSW 11 71,921,359 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AAGGCAAGTCCAGCAAGGTC -3'
(R):5'- ATCCTGAGGAATGTGGACGG -3'

Sequencing Primer
(F):5'- AAGTCCAGCAAGGTCCTGCC -3'
(R):5'- GGTCTGTAGTGCCTAGACTACC -3'
Posted On 2022-04-18