Incidental Mutation 'R9347:Nphs1'
ID 707847
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30471169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 928 (D928G)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: D928G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: D914G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: D914G

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,264,505 M1659K probably benign Het
Ace C A 11: 105,974,132 Q544K probably damaging Het
Agpat4 A G 17: 12,210,281 E140G possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Akap6 A G 12: 53,069,111 Y999C probably damaging Het
Ank1 A G 8: 23,117,060 I1326V possibly damaging Het
Apold1 T A 6: 134,984,036 L151Q probably damaging Het
Arntl A G 7: 113,299,280 D305G possibly damaging Het
BC049352 A G 9: 45,242,973 N44S possibly damaging Het
Brsk2 A G 7: 141,998,396 S564G probably damaging Het
C87414 T A 5: 93,638,838 E24V probably damaging Het
Ceacam18 T C 7: 43,645,491 V325A possibly damaging Het
Clstn2 T C 9: 97,582,601 Y167C probably damaging Het
Cyp11a1 G T 9: 58,020,858 V324L possibly damaging Het
Ddx27 A G 2: 167,020,030 T151A possibly damaging Het
Dhrs4 A G 14: 55,489,849 I252M possibly damaging Het
Dlg2 A G 7: 91,711,692 D6G probably benign Het
Dnah8 G A 17: 30,708,359 E1330K probably benign Het
Ehd3 A G 17: 73,830,396 E520G probably benign Het
Epha5 A G 5: 84,331,872 V91A possibly damaging Het
Fam20c C A 5: 138,757,921 H237Q probably benign Het
Fam217a C T 13: 34,910,679 G366S probably damaging Het
Fancf T C 7: 51,861,611 E215G probably benign Het
Fermt3 A T 19: 7,003,296 I301N probably damaging Het
Fyco1 A T 9: 123,831,285 probably null Het
Gen1 T C 12: 11,261,067 N55D probably damaging Het
Gm20604 A T 12: 102,743,377 C75S unknown Het
Gm3045 T A 13: 56,430,347 V199D unknown Het
Gm49368 A G 7: 128,113,006 T805A possibly damaging Het
Hgf T C 5: 16,604,923 probably null Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Ift140 A G 17: 25,094,779 M1395V probably benign Het
Il17rc T G 6: 113,480,819 probably null Het
Kansl1l T A 1: 66,801,188 T318S probably benign Het
Kcnc1 A T 7: 46,427,610 N279Y probably damaging Het
Khdrbs2 T A 1: 32,472,747 H264Q probably benign Het
Klf12 A G 14: 100,022,708 V195A possibly damaging Het
Lhfpl2 A G 13: 94,192,031 E200G probably damaging Het
Lmna T C 3: 88,486,241 D300G probably damaging Het
Lrif1 A G 3: 106,734,358 T17A possibly damaging Het
Mdm1 A G 10: 118,146,618 I53V probably damaging Het
Mga T A 2: 119,903,037 I122N probably damaging Het
Mos A G 4: 3,871,763 S18P probably benign Het
Mterf3 C T 13: 66,914,788 V295I possibly damaging Het
Muc16 G A 9: 18,660,215 T336I unknown Het
Myo15 T C 11: 60,483,729 S136P Het
Nav3 T A 10: 109,903,094 I128F probably damaging Het
Olfr1026 T A 2: 85,923,475 V69E probably damaging Het
Olfr1037 T C 2: 86,085,567 D70G possibly damaging Het
Olfr1468-ps1 A T 19: 13,375,189 T76S possibly damaging Het
Olfr495 A G 7: 108,396,052 K311E probably benign Het
Olfr625-ps1 A G 7: 103,683,257 I180V probably damaging Het
Parvb T C 15: 84,271,322 probably null Het
Patj A C 4: 98,688,247 E574A probably benign Het
Ppp2r1a A G 17: 20,961,615 N465S probably benign Het
Senp6 A G 9: 80,139,097 K950E possibly damaging Het
Sept12 T C 16: 4,987,617 H304R probably damaging Het
Sept3 T C 15: 82,283,713 V110A probably damaging Het
Slc25a35 G T 11: 68,971,250 V170L probably benign Het
Slco3a1 A T 7: 74,284,405 L673Q possibly damaging Het
Tcp1 A G 17: 12,917,800 M23V probably benign Het
Thg1l T C 11: 45,954,461 probably benign Het
Tiam2 G A 17: 3,421,648 E522K probably benign Het
Tie1 G A 4: 118,484,670 T194I possibly damaging Het
Vmn2r49 T A 7: 9,984,747 E463D probably benign Het
Wdr1 C A 5: 38,540,012 probably null Het
Zbtb38 A T 9: 96,685,596 M1145K probably damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGGGGTCCCTCTGGATC -3'
(R):5'- ATCTTGGCAGGTGACCCAAG -3'

Sequencing Primer
(F):5'- GGTCCCTCTGGATCTCCAAGAC -3'
(R):5'- GGTGACCCAAGTACCTGAC -3'
Posted On 2022-04-18