Incidental Mutation 'R0743:Senp6'
ID70785
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0743 (G1)
Quality Score159
Status Not validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80093589 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 27 (R27C)
Ref Sequence ENSEMBL: ENSMUSP00000135494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176640]
Predicted Effect probably benign
Transcript: ENSMUST00000037484
AA Change: R134C

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: R134C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164859
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165607
AA Change: R134C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: R134C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175673
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect possibly damaging
Transcript: ENSMUST00000176360
AA Change: R55C

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000176640
AA Change: R27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 unclassified probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCCTAGTGGACAACAGTAGATGC -3'
(R):5'- GGCCAACTAAGTACAGTTCAATCCAGT -3'

Sequencing Primer
(F):5'- aattttaGTGTACAATTTGGGTTTGC -3'
(R):5'- GTTCAATCCAGTACAGTAAGGTCAG -3'
Posted On2013-09-30