Mutagenetix > Incidental Mutations

Incidental Mutation 'R0743:Nphp3'

70786

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

038924-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0743 (G1)

Quality Score

117

Status

Not validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

GCATCATCATCATCATC to GCATCATCATCATC at 104022768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

probably benign
Transcript: ENSMUST00000035167

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129819

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193439

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193642

Predicted Effect

probably benign
Transcript: ENSMUST00000194774

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.7%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	T	14: 118,553,288	I844N	possibly damaging	Het
Bend7	A	T	2: 4,744,244	K57N	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Csmd2	A	T	4: 128,113,676	T149S	probably benign	Het
Cyp2a12	T	C	7: 27,032,542	I236T	probably benign	Het
Dnase1l2	A	G	17: 24,441,880	V170A	possibly damaging	Het
Dnm2	T	A	9: 21,500,265	Y597N	probably damaging	Het
Epsti1	A	T	14: 77,931,275	R117S	probably damaging	Het
Gabarapl2	A	T	8: 111,942,505	I32F	probably damaging	Het
Glrb	T	A	3: 80,879,680	I59F	probably damaging	Het
Gm13089	A	T	4: 143,698,564	I103N	probably damaging	Het
Gm17689	T	C	9: 36,581,301	S103G	probably benign	Het
Gosr1	A	G	11: 76,730,146	I239T	probably benign	Het
Kif5b	G	T	18: 6,209,192	R857S	probably damaging	Het
Kmt5a	C	A	5: 124,447,219	N44K	probably damaging	Het
Ksr1	A	T	11: 79,021,503	H675Q	possibly damaging	Het
Maats1	A	G	16: 38,335,634	F76L	possibly damaging	Het
Mep1b	A	G	18: 21,080,458	D68G	possibly damaging	Het
Nebl	A	C	2: 17,411,118	S327A	probably benign	Het
Nfat5	G	A	8: 107,368,066	E962K	probably damaging	Het
Nfatc4	A	C	14: 55,826,644	D126A	probably damaging	Het
Nmt2	A	T	2: 3,314,785	R271*	probably null	Het
Nol7	G	A	13: 43,400,615	V133I	probably benign	Het
Npepps	A	G	11: 97,206,058		probably benign	Het
Olfr1100	G	A	2: 86,978,499	T99I	probably benign	Het
Olfr376	A	T	11: 73,374,889	I47F	probably benign	Het
Olfr610	C	T	7: 103,506,862	W28*	probably null	Het
Olfr798	T	A	10: 129,625,843	T73S	probably benign	Het
Ovgp1	T	A	3: 105,974,932	L37H	probably damaging	Het
Padi3	G	T	4: 140,786,429	A646D	probably benign	Het
Pamr1	A	G	2: 102,609,907	E142G	probably damaging	Het
Papolg	A	T	11: 23,870,818		probably null	Het
Pfkl	C	T	10: 77,995,243		probably null	Het
Plrg1	T	C	3: 83,059,917	S132P	probably benign	Het
Prr14l	C	A	5: 32,831,194	C319F	possibly damaging	Het
Prtn3	T	A	10: 79,879,677	M1K	probably null	Het
Ptpn22	T	C	3: 103,902,171	F700S	probably damaging	Het
Ptprz1	C	T	6: 23,044,367	Q1273*	probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ryr2	T	C	13: 11,554,529	D4963G	probably damaging	Het
Sec16a	G	A	2: 26,419,722	L2091F	possibly damaging	Het
Senp6	C	T	9: 80,093,589	R27C	probably damaging	Het
Shcbp1	T	A	8: 4,764,906	M191L	probably benign	Het
Sirt4	T	C	5: 115,482,955	K53E	probably benign	Het
Slc10a2	A	G	8: 5,089,132	S271P	probably damaging	Het
Slc35b2	T	A	17: 45,566,825	F293I	probably damaging	Het
Slc38a10	C	T	11: 120,140,643	V103M	probably damaging	Het
St5	A	G	7: 109,557,345	L66P	probably damaging	Het
Stab2	T	A	10: 86,887,895	I1479F	probably damaging	Het
Synpo2	A	G	3: 123,112,706	V987A	probably benign	Het
Syt9	A	G	7: 107,436,561	I262V	probably damaging	Het
Taf2	GCTTCTTCTTCTTCTTCTT	GCTTCTTCTTCTTCTT	15: 55,016,461		probably benign	Het
Tmem39a	A	T	16: 38,585,402	I200F	probably damaging	Het
Ttn	G	A	2: 76,749,269	T23760M	probably damaging	Het
Uqcrc1	C	T	9: 108,944,705	Q22*	probably null	Het
Wdtc1	A	G	4: 133,300,661	W377R	probably damaging	Het
Zfp454	A	G	11: 50,873,937	S223P	probably benign	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCGTGGAGTACGGCTGATTTG -3'
(R):5'- CCCCATAGCTCTCCAGTGGGATAAAAG -3'

Sequencing Primer
(F):5'- AGTACGGCTGATTTGTTTAGCG -3'
(R):5'- tgggaggcagagacagg -3'

Posted On

2013-09-30