Incidental Mutation 'R9347:Abca17'
ID 707889
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24264505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1659 (M1659K)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: M1659K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: M1659K

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: M1659K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: M1659K

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C A 11: 105,974,132 Q544K probably damaging Het
Agpat4 A G 17: 12,210,281 E140G possibly damaging Het
Akap12 A G 10: 4,353,640 D150G probably benign Het
Akap6 A G 12: 53,069,111 Y999C probably damaging Het
Ank1 A G 8: 23,117,060 I1326V possibly damaging Het
Apold1 T A 6: 134,984,036 L151Q probably damaging Het
Arntl A G 7: 113,299,280 D305G possibly damaging Het
BC049352 A G 9: 45,242,973 N44S possibly damaging Het
Brsk2 A G 7: 141,998,396 S564G probably damaging Het
C87414 T A 5: 93,638,838 E24V probably damaging Het
Ceacam18 T C 7: 43,645,491 V325A possibly damaging Het
Clstn2 T C 9: 97,582,601 Y167C probably damaging Het
Cyp11a1 G T 9: 58,020,858 V324L possibly damaging Het
Ddx27 A G 2: 167,020,030 T151A possibly damaging Het
Dhrs4 A G 14: 55,489,849 I252M possibly damaging Het
Dlg2 A G 7: 91,711,692 D6G probably benign Het
Dnah8 G A 17: 30,708,359 E1330K probably benign Het
Ehd3 A G 17: 73,830,396 E520G probably benign Het
Epha5 A G 5: 84,331,872 V91A possibly damaging Het
Fam20c C A 5: 138,757,921 H237Q probably benign Het
Fam217a C T 13: 34,910,679 G366S probably damaging Het
Fancf T C 7: 51,861,611 E215G probably benign Het
Fermt3 A T 19: 7,003,296 I301N probably damaging Het
Fyco1 A T 9: 123,831,285 probably null Het
Gen1 T C 12: 11,261,067 N55D probably damaging Het
Gm20604 A T 12: 102,743,377 C75S unknown Het
Gm3045 T A 13: 56,430,347 V199D unknown Het
Gm49368 A G 7: 128,113,006 T805A possibly damaging Het
Hgf T C 5: 16,604,923 probably null Het
Hnrnpul2 T A 19: 8,820,716 H145Q probably benign Het
Ift140 A G 17: 25,094,779 M1395V probably benign Het
Il17rc T G 6: 113,480,819 probably null Het
Kansl1l T A 1: 66,801,188 T318S probably benign Het
Kcnc1 A T 7: 46,427,610 N279Y probably damaging Het
Khdrbs2 T A 1: 32,472,747 H264Q probably benign Het
Klf12 A G 14: 100,022,708 V195A possibly damaging Het
Lhfpl2 A G 13: 94,192,031 E200G probably damaging Het
Lmna T C 3: 88,486,241 D300G probably damaging Het
Lrif1 A G 3: 106,734,358 T17A possibly damaging Het
Mdm1 A G 10: 118,146,618 I53V probably damaging Het
Mga T A 2: 119,903,037 I122N probably damaging Het
Mos A G 4: 3,871,763 S18P probably benign Het
Mterf3 C T 13: 66,914,788 V295I possibly damaging Het
Muc16 G A 9: 18,660,215 T336I unknown Het
Myo15 T C 11: 60,483,729 S136P Het
Nav3 T A 10: 109,903,094 I128F probably damaging Het
Nphs1 A G 7: 30,471,169 D928G probably damaging Het
Olfr1026 T A 2: 85,923,475 V69E probably damaging Het
Olfr1037 T C 2: 86,085,567 D70G possibly damaging Het
Olfr1468-ps1 A T 19: 13,375,189 T76S possibly damaging Het
Olfr495 A G 7: 108,396,052 K311E probably benign Het
Olfr625-ps1 A G 7: 103,683,257 I180V probably damaging Het
Parvb T C 15: 84,271,322 probably null Het
Patj A C 4: 98,688,247 E574A probably benign Het
Ppp2r1a A G 17: 20,961,615 N465S probably benign Het
Senp6 A G 9: 80,139,097 K950E possibly damaging Het
Sept12 T C 16: 4,987,617 H304R probably damaging Het
Sept3 T C 15: 82,283,713 V110A probably damaging Het
Slc25a35 G T 11: 68,971,250 V170L probably benign Het
Slco3a1 A T 7: 74,284,405 L673Q possibly damaging Het
Tcp1 A G 17: 12,917,800 M23V probably benign Het
Thg1l T C 11: 45,954,461 probably benign Het
Tiam2 G A 17: 3,421,648 E522K probably benign Het
Tie1 G A 4: 118,484,670 T194I possibly damaging Het
Vmn2r49 T A 7: 9,984,747 E463D probably benign Het
Wdr1 C A 5: 38,540,012 probably null Het
Zbtb38 A T 9: 96,685,596 M1145K probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
R9440:Abca17 UTSW 17 24280478 missense probably benign 0.02
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGCGAACACAGGCTACCC -3'
(R):5'- CCTTATGTGCAGCAACTGGC -3'

Sequencing Primer
(F):5'- AGCTCTTTATTACAGAAGGATGGGC -3'
(R):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
Posted On 2022-04-18