Incidental Mutation 'R9348:Bpifb9b'
ID 707903
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene Name BPI fold containing family B, member 9B
Synonyms OTTMUSG00000015915, 5430413K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9348 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 154307227-154320646 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 154318846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 546 (S546T)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
AlphaFold A2AJD1
Predicted Effect probably benign
Transcript: ENSMUST00000088921
AA Change: S546T

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: S546T

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 C T 8: 40,755,916 P740S probably benign Het
Arfgef1 G T 1: 10,213,194 H163Q probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Auts2 T C 5: 131,461,317 T165A Het
BC034090 A G 1: 155,223,303 S579P probably benign Het
C4b C T 17: 34,733,185 V1229I probably benign Het
Cadps2 T C 6: 23,344,263 D895G probably benign Het
Cep112 T C 11: 108,437,250 S51P probably damaging Het
Cep164 T C 9: 45,806,410 H545R unknown Het
Creb3l1 C T 2: 91,991,886 probably null Het
Crlf1 T A 8: 70,498,666 I65K probably benign Het
Crybg3 T C 16: 59,600,893 M1V probably null Het
Cyb5d1 T A 11: 69,395,004 I69L probably damaging Het
D430041D05Rik T C 2: 104,257,992 D213G probably benign Het
Dennd5a C G 7: 109,899,723 probably null Het
Dennd5a T A 7: 109,899,735 M998L probably benign Het
E2f1 T A 2: 154,560,835 E382D probably benign Het
Enpep T A 3: 129,309,123 T395S probably benign Het
Gm20939 A G 17: 94,875,549 E71G probably damaging Het
Hs1bp3 T A 12: 8,336,273 V225E probably benign Het
Icam5 T C 9: 21,032,131 M1T probably null Het
Ifi205 T C 1: 174,017,431 I262V probably benign Het
Iqce T C 5: 140,691,625 Y147C probably damaging Het
Kcnh2 C T 5: 24,333,005 G120E probably damaging Het
Kif3c A G 12: 3,367,505 T509A probably benign Het
Napepld A T 5: 21,670,492 N351K probably benign Het
Ndufaf3 C A 9: 108,566,158 probably null Het
Nlrp9b C T 7: 20,023,411 T191I probably damaging Het
Olfr123 T C 17: 37,796,101 I219T probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr263 T A 13: 21,132,961 F62Y possibly damaging Het
Olfr43 T A 11: 74,206,463 Y251F probably damaging Het
Oog2 T C 4: 144,195,219 L233P probably damaging Het
Preb A G 5: 30,955,651 F416L probably benign Het
Prickle2 C T 6: 92,420,262 V217I probably benign Het
Prss45 T A 9: 110,839,210 I157N probably damaging Het
Ranbp17 T C 11: 33,479,232 T338A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spert A G 14: 75,583,398 S296P probably damaging Het
Srpk2 A T 5: 23,514,673 F578I probably damaging Het
Stx2 A T 5: 128,999,537 D27E probably benign Het
Tgfbrap1 A G 1: 43,054,535 I599T probably benign Het
Trim25 G T 11: 89,009,341 E305* probably null Het
Ttll7 T A 3: 146,968,013 I821N probably benign Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zcchc9 T A 13: 91,806,067 D23V Het
Zfp141 C A 7: 42,475,390 E553* probably null Het
Zfyve26 T C 12: 79,268,457 D1415G possibly damaging Het
Zpbp2 C T 11: 98,551,315 probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154316951 splice site probably null
IGL02119:Bpifb9b APN 2 154313624 missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154311281 missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154317075 missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154311314 missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154309604 missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154319675 missense possibly damaging 0.53
R2200:Bpifb9b UTSW 2 154313654 missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154311742 missense probably benign
R4755:Bpifb9b UTSW 2 154319694 missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154313631 missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154314106 splice site probably null
R4915:Bpifb9b UTSW 2 154314106 splice site probably null
R4917:Bpifb9b UTSW 2 154314106 splice site probably null
R4918:Bpifb9b UTSW 2 154314106 splice site probably null
R4950:Bpifb9b UTSW 2 154311659 missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154309368 missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154317027 missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154309364 missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154311672 missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154313615 missense possibly damaging 0.95
R7736:Bpifb9b UTSW 2 154312105 missense probably benign 0.00
R8536:Bpifb9b UTSW 2 154316277 missense probably benign 0.00
R9134:Bpifb9b UTSW 2 154309521 missense probably benign
R9528:Bpifb9b UTSW 2 154311377 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCCATCTCACATTGATCTTGAC -3'
(R):5'- AAGGCTTCTTGGGAGGCAAC -3'

Sequencing Primer
(F):5'- TTGATCTTGACACATGACAGACCTC -3'
(R):5'- CCTATTAACCAGGGATTGCTGTC -3'
Posted On 2022-04-18