Incidental Mutation 'R9348:Oog2'
ID 707907
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Name oogenesin 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9348 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 144190719-144196934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144195219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 233 (L233P)
Ref Sequence ENSEMBL: ENSMUSP00000079267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
AlphaFold Q7TPX8
Predicted Effect probably damaging
Transcript: ENSMUST00000080405
AA Change: L233P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030
AA Change: L233P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 C T 8: 40,755,916 P740S probably benign Het
Arfgef1 G T 1: 10,213,194 H163Q probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp6v1h T A 1: 5,117,476 D222E probably damaging Het
Auts2 T C 5: 131,461,317 T165A Het
BC034090 A G 1: 155,223,303 S579P probably benign Het
Bpifb9b T A 2: 154,318,846 S546T probably benign Het
C4b C T 17: 34,733,185 V1229I probably benign Het
Cadps2 T C 6: 23,344,263 D895G probably benign Het
Cep112 T C 11: 108,437,250 S51P probably damaging Het
Cep164 T C 9: 45,806,410 H545R unknown Het
Creb3l1 C T 2: 91,991,886 probably null Het
Crlf1 T A 8: 70,498,666 I65K probably benign Het
Crybg3 T C 16: 59,600,893 M1V probably null Het
Cyb5d1 T A 11: 69,395,004 I69L probably damaging Het
D430041D05Rik T C 2: 104,257,992 D213G probably benign Het
Dennd5a C G 7: 109,899,723 probably null Het
Dennd5a T A 7: 109,899,735 M998L probably benign Het
E2f1 T A 2: 154,560,835 E382D probably benign Het
Enpep T A 3: 129,309,123 T395S probably benign Het
Gm20939 A G 17: 94,875,549 E71G probably damaging Het
Hs1bp3 T A 12: 8,336,273 V225E probably benign Het
Icam5 T C 9: 21,032,131 M1T probably null Het
Ifi205 T C 1: 174,017,431 I262V probably benign Het
Iqce T C 5: 140,691,625 Y147C probably damaging Het
Kcnh2 C T 5: 24,333,005 G120E probably damaging Het
Kif3c A G 12: 3,367,505 T509A probably benign Het
Napepld A T 5: 21,670,492 N351K probably benign Het
Ndufaf3 C A 9: 108,566,158 probably null Het
Nlrp9b C T 7: 20,023,411 T191I probably damaging Het
Olfr123 T C 17: 37,796,101 I219T probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr263 T A 13: 21,132,961 F62Y possibly damaging Het
Olfr43 T A 11: 74,206,463 Y251F probably damaging Het
Preb A G 5: 30,955,651 F416L probably benign Het
Prickle2 C T 6: 92,420,262 V217I probably benign Het
Prss45 T A 9: 110,839,210 I157N probably damaging Het
Ranbp17 T C 11: 33,479,232 T338A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spert A G 14: 75,583,398 S296P probably damaging Het
Srpk2 A T 5: 23,514,673 F578I probably damaging Het
Stx2 A T 5: 128,999,537 D27E probably benign Het
Tgfbrap1 A G 1: 43,054,535 I599T probably benign Het
Trim25 G T 11: 89,009,341 E305* probably null Het
Ttll7 T A 3: 146,968,013 I821N probably benign Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zcchc9 T A 13: 91,806,067 D23V Het
Zfp141 C A 7: 42,475,390 E553* probably null Het
Zfyve26 T C 12: 79,268,457 D1415G possibly damaging Het
Zpbp2 C T 11: 98,551,315 probably benign Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R0892:Oog2 UTSW 4 144196499 missense probably benign 0.00
R1024:Oog2 UTSW 4 144196286 missense probably damaging 1.00
R4156:Oog2 UTSW 4 144193953 intron probably benign
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 splice site probably null
R6487:Oog2 UTSW 4 144196485 missense possibly damaging 0.48
R6946:Oog2 UTSW 4 144196464 missense possibly damaging 0.95
R7000:Oog2 UTSW 4 144195327 missense probably damaging 1.00
R7167:Oog2 UTSW 4 144195175 missense probably benign 0.04
R7303:Oog2 UTSW 4 144195342 missense probably benign 0.04
R7399:Oog2 UTSW 4 144195281 missense probably benign 0.01
R8004:Oog2 UTSW 4 144194251 missense probably benign 0.00
R8141:Oog2 UTSW 4 144194207 missense probably damaging 0.97
R8411:Oog2 UTSW 4 144194173 missense probably damaging 1.00
R8932:Oog2 UTSW 4 144194115 missense probably benign 0.00
R9290:Oog2 UTSW 4 144196445 missense probably benign 0.02
R9614:Oog2 UTSW 4 144196137 missense probably damaging 1.00
RF009:Oog2 UTSW 4 144195285 missense probably benign 0.36
Z1177:Oog2 UTSW 4 144194015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTCATCTACACTGTAGAAAGC -3'
(R):5'- GTGACCAGACCATCATGGAC -3'

Sequencing Primer
(F):5'- CTGTAGAAAGCTGAAAATTTATGGC -3'
(R):5'- GAAAGAGAAGAGAGGTGTTTTCTC -3'
Posted On 2022-04-18