Incidental Mutation 'R0743:Papolg'
List |< first << previous [record 33 of 58] next >> last >|
ID70792
Institutional Source Beutler Lab
Gene Symbol Papolg
Ensembl Gene ENSMUSG00000020273
Gene Namepoly(A) polymerase gamma
Synonyms
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23862646-23895253 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 23870818 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020513] [ENSMUST00000102863]
Predicted Effect probably null
Transcript: ENSMUST00000020513
AA Change: L404*
SMART Domains Protein: ENSMUSP00000020513
Gene: ENSMUSG00000020273
AA Change: L404*

DomainStartEndE-ValueType
Pfam:PAP_central 20 363 1.4e-118 PFAM
Pfam:NTP_transf_2 53 174 2.8e-15 PFAM
Pfam:PAP_RNA-bind 365 431 2.4e-22 PFAM
Pfam:PAP_RNA-bind 421 506 1.2e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102863
AA Change: L404*
SMART Domains Protein: ENSMUSP00000099927
Gene: ENSMUSG00000020273
AA Change: L404*

DomainStartEndE-ValueType
Pfam:PAP_central 16 364 1.5e-111 PFAM
Pfam:NTP_transf_2 89 174 9.2e-12 PFAM
Pfam:PAP_RNA-bind 365 429 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145013
SMART Domains Protein: ENSMUSP00000115518
Gene: ENSMUSG00000020273

DomainStartEndE-ValueType
SCOP:d1f5aa1 2 29 3e-10 SMART
PDB:4LT6|B 2 38 4e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150711
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(A) polymerase family which catalyzes template-independent extension of the 3' end of a DNA/RNA strand. This enzyme shares 60% identity to the well characterized poly(A) polymerase II (PAPII) at the amino acid level. These two enzymes have similar organization of structural and functional domains. This enzyme is exclusively localized in the nucleus and exhibits both nonspecific and CPSF (cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome 2 in contrast to the PAPII gene, which is located on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Papolg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Papolg APN 11 23876377 missense possibly damaging 0.93
IGL01016:Papolg APN 11 23885570 missense possibly damaging 0.58
IGL01394:Papolg APN 11 23867235 missense probably benign
IGL01710:Papolg APN 11 23864026 missense probably damaging 0.99
IGL01786:Papolg APN 11 23874488 missense probably damaging 1.00
IGL02008:Papolg APN 11 23879898 missense probably damaging 1.00
IGL02127:Papolg APN 11 23870870 unclassified probably benign
IGL02329:Papolg APN 11 23891869 missense probably damaging 0.98
IGL02535:Papolg APN 11 23890245 missense probably benign 0.00
IGL02588:Papolg APN 11 23890252 missense probably damaging 1.00
IGL03058:Papolg APN 11 23895029 missense probably benign 0.00
IGL03301:Papolg APN 11 23874503 missense probably benign 0.05
Runningback UTSW 11 23873919 splice site probably null
R0124:Papolg UTSW 11 23867535 missense probably benign 0.21
R0369:Papolg UTSW 11 23872425 critical splice donor site probably null
R0454:Papolg UTSW 11 23879868 splice site probably null
R0931:Papolg UTSW 11 23882257 missense probably damaging 0.96
R1856:Papolg UTSW 11 23867379 missense probably benign 0.06
R1940:Papolg UTSW 11 23867279 missense probably benign 0.00
R2239:Papolg UTSW 11 23876378 missense probably damaging 0.99
R3802:Papolg UTSW 11 23876449 missense probably damaging 1.00
R4275:Papolg UTSW 11 23868378 missense probably benign
R4989:Papolg UTSW 11 23873919 splice site probably null
R5074:Papolg UTSW 11 23867331 missense possibly damaging 0.78
R5122:Papolg UTSW 11 23867501 critical splice donor site probably null
R6048:Papolg UTSW 11 23891815 missense probably benign 0.04
R6365:Papolg UTSW 11 23882290 missense probably damaging 1.00
R6577:Papolg UTSW 11 23879857 critical splice donor site probably benign
R7117:Papolg UTSW 11 23895207 start gained probably benign
R7283:Papolg UTSW 11 23867394 missense not run
R7372:Papolg UTSW 11 23866439 missense probably benign 0.16
R7761:Papolg UTSW 11 23891884 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTCCACCAATACCTGTTAAGGACAGTC -3'
(R):5'- TGCTTCTTTCAGGAGTTAAGTGCCTAC -3'

Sequencing Primer
(F):5'- CCTGTTAAGGACAGTCTTAAAACTC -3'
(R):5'- ccttccgctgtgactcc -3'
Posted On2013-09-30