Mutagenetix > Incidental Mutation

Incidental Mutation 'R9349:Adam19'

707972

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9349 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 46131743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 508 (E508*)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

AlphaFold

O35674

Predicted Effect

probably null
Transcript: ENSMUST00000011400
AA Change: E508*

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: E508*

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	A	G	8: 12,279,665	Q40R	unknown	Het
A730015C16Rik	C	T	4: 108,847,856	V89I	unknown	Het
Arhgef33	C	T	17: 80,337,307	Q22*	probably null	Het
Arih2	C	G	9: 108,611,739	R260P	probably damaging	Het
Astn2	T	A	4: 66,266,255	T202S	unknown	Het
Bpifb5	T	A	2: 154,225,085	L86Q	possibly damaging	Het
Brpf3	G	A	17: 28,821,302	S899N	probably benign	Het
Ccl20	T	C	1: 83,117,865	F49S		Het
Ctse	A	G	1: 131,664,373	T146A	probably benign	Het
Dhx35	T	C	2: 158,829,524	S292P	possibly damaging	Het
Fut7	C	T	2: 25,424,981	P84S	possibly damaging	Het
Gm8926	C	T	5: 11,773,254	T130I	possibly damaging	Het
Gm9736	A	C	10: 77,750,559	S266A	unknown	Het
Gsdma	T	A	11: 98,675,945	L366Q	probably benign	Het
Ifna15	T	A	4: 88,558,046	D67V	probably benign	Het
Igkv2-112	G	A	6: 68,220,694	V117I	probably benign	Het
Kcnh2	C	T	5: 24,333,005	G120E	probably damaging	Het
Kcnip1	T	G	11: 33,651,548	Y29S	probably benign	Het
Lrrc37a	T	G	11: 103,497,628	M2324L	unknown	Het
Mettl5	T	A	2: 69,871,769	D185V	possibly damaging	Het
Mmp1b	T	A	9: 7,369,271	M359L	probably benign	Het
Ndufa5	G	A	6: 24,522,750	T31I	probably benign	Het
Ngly1	T	A	14: 16,281,801	C352*	probably null	Het
Olfr297	A	G	7: 86,527,165	H136R	probably benign	Het
Olfr33	A	T	7: 102,713,668	C248*	probably null	Het
Pcdhac1	C	T	18: 37,090,968	A278V	possibly damaging	Het
Ppp2r3c	T	A	12: 55,298,483	K73N	probably benign	Het
Rasgrf1	T	C	9: 90,002,407	V975A	probably damaging	Het
Rps27rt	C	T	9: 114,982,605	V35M	probably benign	Het
Slc22a8	A	G	19: 8,594,105	N67D	probably benign	Het
Slc39a6	C	A	18: 24,585,436	M521I	probably benign	Het
Snx31	C	T	15: 36,555,285	S39N	probably damaging	Het
Sv2a	T	C	3: 96,189,479		probably null	Het
Thg1l	G	A	11: 45,955,446	A7V	probably benign	Het
Ttc39c	C	T	18: 12,689,875	Q147*	probably null	Het
Ube2u	A	G	4: 100,549,997	N352D	unknown	Het
Uhrf1	T	C	17: 56,310,737	V153A	possibly damaging	Het
Wdfy4	A	G	14: 33,154,039	S143P		Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0488:Adam19	UTSW	11	46138930	missense	probably damaging	0.98
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	splice site	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4506:Adam19	UTSW	11	46118444	missense	possibly damaging	0.67
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5313:Adam19	UTSW	11	46131776	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R5602:Adam19	UTSW	11	46136315	missense	probably benign
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R8012:Adam19	UTSW	11	46065046	missense	possibly damaging	0.74
R8059:Adam19	UTSW	11	46136466	splice site	probably benign
R8243:Adam19	UTSW	11	46125082	missense	probably damaging	1.00
R8357:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R8419:Adam19	UTSW	11	46125023	missense	possibly damaging	0.77
R8457:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R9163:Adam19	UTSW	11	46127349	missense	probably benign	0.02
R9489:Adam19	UTSW	11	46137622	missense	probably benign	0.10
R9579:Adam19	UTSW	11	46118435	missense	not run
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- CAAGGTCGTCAAAACTGTTTTCC -3'
(R):5'- AGGTGTTCTAGGCCAAGCTAAAG -3'

Sequencing Primer
(F):5'- CCACAGATAGGATGTTCATGAGCTC -3'
(R):5'- CCAAGCTAAAGGGCCAGCG -3'

Posted On

2022-04-18