Incidental Mutation 'R9349:Adam19'
ID 707972
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Name a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms Mltnb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9349 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 46055992-46147343 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 46131743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 508 (E508*)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
AlphaFold O35674
Predicted Effect probably null
Transcript: ENSMUST00000011400
AA Change: E508*
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: E508*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,665 Q40R unknown Het
A730015C16Rik C T 4: 108,847,856 V89I unknown Het
Arhgef33 C T 17: 80,337,307 Q22* probably null Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Astn2 T A 4: 66,266,255 T202S unknown Het
Bpifb5 T A 2: 154,225,085 L86Q possibly damaging Het
Brpf3 G A 17: 28,821,302 S899N probably benign Het
Ccl20 T C 1: 83,117,865 F49S Het
Ctse A G 1: 131,664,373 T146A probably benign Het
Dhx35 T C 2: 158,829,524 S292P possibly damaging Het
Fut7 C T 2: 25,424,981 P84S possibly damaging Het
Gm8926 C T 5: 11,773,254 T130I possibly damaging Het
Gm9736 A C 10: 77,750,559 S266A unknown Het
Gsdma T A 11: 98,675,945 L366Q probably benign Het
Ifna15 T A 4: 88,558,046 D67V probably benign Het
Igkv2-112 G A 6: 68,220,694 V117I probably benign Het
Kcnh2 C T 5: 24,333,005 G120E probably damaging Het
Kcnip1 T G 11: 33,651,548 Y29S probably benign Het
Lrrc37a T G 11: 103,497,628 M2324L unknown Het
Mettl5 T A 2: 69,871,769 D185V possibly damaging Het
Mmp1b T A 9: 7,369,271 M359L probably benign Het
Ndufa5 G A 6: 24,522,750 T31I probably benign Het
Ngly1 T A 14: 16,281,801 C352* probably null Het
Olfr297 A G 7: 86,527,165 H136R probably benign Het
Olfr33 A T 7: 102,713,668 C248* probably null Het
Pcdhac1 C T 18: 37,090,968 A278V possibly damaging Het
Ppp2r3c T A 12: 55,298,483 K73N probably benign Het
Rasgrf1 T C 9: 90,002,407 V975A probably damaging Het
Rps27rt C T 9: 114,982,605 V35M probably benign Het
Slc22a8 A G 19: 8,594,105 N67D probably benign Het
Slc39a6 C A 18: 24,585,436 M521I probably benign Het
Snx31 C T 15: 36,555,285 S39N probably damaging Het
Sv2a T C 3: 96,189,479 probably null Het
Thg1l G A 11: 45,955,446 A7V probably benign Het
Ttc39c C T 18: 12,689,875 Q147* probably null Het
Ube2u A G 4: 100,549,997 N352D unknown Het
Uhrf1 T C 17: 56,310,737 V153A possibly damaging Het
Wdfy4 A G 14: 33,154,039 S143P Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 splice site probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
R7896:Adam19 UTSW 11 46137543 missense probably damaging 1.00
R8012:Adam19 UTSW 11 46065046 missense possibly damaging 0.74
R8059:Adam19 UTSW 11 46136466 splice site probably benign
R8243:Adam19 UTSW 11 46125082 missense probably damaging 1.00
R8357:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R8419:Adam19 UTSW 11 46125023 missense possibly damaging 0.77
R8457:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R9163:Adam19 UTSW 11 46127349 missense probably benign 0.02
R9489:Adam19 UTSW 11 46137622 missense probably benign 0.10
R9579:Adam19 UTSW 11 46118435 missense not run
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- CAAGGTCGTCAAAACTGTTTTCC -3'
(R):5'- AGGTGTTCTAGGCCAAGCTAAAG -3'

Sequencing Primer
(F):5'- CCACAGATAGGATGTTCATGAGCTC -3'
(R):5'- CCAAGCTAAAGGGCCAGCG -3'
Posted On 2022-04-18