Mutagenetix > Incidental Mutations

Incidental Mutation 'R9350:Serpinb13'

707989

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R9350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 106995832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 89 (L89*)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably null
Transcript: ENSMUST00000027564
AA Change: L89*

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: L89*

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000136766
AA Change: *111R

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: *111R

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	A	8: 43,569,632	M274L	probably benign	Het
Adarb1	T	A	10: 77,322,433	N60I	possibly damaging	Het
Adgrv1	T	A	13: 81,506,155	N2919I	probably damaging	Het
Adora3	C	T	3: 105,907,297	T121M	possibly damaging	Het
Arhgap19	A	T	19: 41,773,127	F466Y	probably benign	Het
Arih2	C	G	9: 108,611,739	R260P	probably damaging	Het
Atxn7l1	C	T	12: 33,367,316	T492I	probably benign	Het
B3galnt2	T	C	13: 13,995,808	S248P	probably damaging	Het
Casp2	T	C	6: 42,269,398	V230A	probably benign	Het
Creb3l1	C	T	2: 91,991,886		probably null	Het
Ctnnbl1	G	A	2: 157,809,525	G240E	possibly damaging	Het
Dennd2c	T	C	3: 103,131,992	L152P	possibly damaging	Het
Dhx16	T	A	17: 35,889,311	F874Y	probably damaging	Het
Dnah14	A	T	1: 181,734,804	Y2643F	possibly damaging	Het
Dnah2	C	A	11: 69,493,247	V1048L	probably benign	Het
Dnah7a	T	C	1: 53,397,148	I4012V	probably benign	Het
Duox2	G	A	2: 122,285,248	R1002*	probably null	Het
Ears2	T	A	7: 122,044,563	K391*	probably null	Het
Eif4e	T	C	3: 138,553,709	V176A	probably benign	Het
Erbb4	T	A	1: 68,290,479	I626L	probably benign	Het
Fam171a1	C	T	2: 3,225,000	T390I	probably benign	Het
Fam187b	A	G	7: 30,977,612	E182G	possibly damaging	Het
Fam204a	A	G	19: 60,221,253	V15A	probably benign	Het
Fscn3	C	T	6: 28,430,433	R201*	probably null	Het
Fzd6	A	G	15: 39,031,648	D403G	probably damaging	Het
Gars	G	A	6: 55,052,264	A210T	probably null	Het
Gmcl1	A	T	6: 86,700,587	I428N	probably damaging	Het
Gmip	T	A	8: 69,811,182	I92N	probably damaging	Het
Il17rc	G	A	6: 113,479,087	V298I	probably damaging	Het
Kifap3	A	G	1: 163,783,061	I37V	probably benign	Het
Marf1	T	C	16: 14,145,925	K505E	probably damaging	Het
Masp2	A	T	4: 148,607,939		probably null	Het
Mmp15	G	A	8: 95,366,374	R127H	probably damaging	Het
Nrd1	A	G	4: 109,032,461	T402A	possibly damaging	Het
Olfr731	T	A	14: 50,237,950	I312L	probably benign	Het
Olfr934	A	T	9: 38,982,785	N86K	probably benign	Het
Papln	A	T	12: 83,786,864	I1185F	probably damaging	Het
Pcdhgb1	A	G	18: 37,681,652	N399D	probably benign	Het
Pcdhgb6	T	A	18: 37,743,819	S527T	probably benign	Het
Phkb	T	A	8: 86,016,864	Y530*	probably null	Het
Pira2	A	G	7: 3,841,031	S581P	probably benign	Het
Pou4f3	A	T	18: 42,395,264	T91S	probably benign	Het
Prpf38a	A	G	4: 108,566,915	S296P	unknown	Het
Rnf213	T	C	11: 119,442,149	V2729A		Het
Rtl1	G	A	12: 109,590,792	Q1538*	probably null	Het
Sars2	T	C	7: 28,747,848	S224P	probably damaging	Het
Senp8	A	G	9: 59,737,822	V17A	probably benign	Het
Sh3bp2	T	A	5: 34,561,109		probably null	Het
Shank2	A	G	7: 144,407,208	T254A	probably benign	Het
Smdt1	A	T	15: 82,347,303	E12D	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Svs1	A	T	6: 48,988,326	N423Y	probably damaging	Het
Taar2	A	G	10: 23,941,447	N295S	probably damaging	Het
Trim24	A	G	6: 37,915,273	Q247R	probably damaging	Het
Trpc4	T	A	3: 54,302,189	N658K	probably damaging	Het
Ube2e1	T	C	14: 18,284,348	D137G	probably damaging	Het
Ubn1	T	A	16: 5,081,558	H1055Q	probably benign	Het
Vmn1r235	A	G	17: 21,261,928	T172A	probably benign	Het
Vps13d	A	G	4: 145,155,763	F1087L		Het
Xirp2	T	C	2: 67,519,309	S3283P	probably damaging	Het
Zeb2	C	A	2: 44,997,146	S633I	possibly damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTGGCAGAAAGTCAAATGGC -3'
(R):5'- AATAGTCCCATGGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCAAATGGCAGTGGGGAC -3'
(R):5'- GCCATTTCTTGGTACCAC -3'

Posted On

2022-04-18