Incidental Mutation 'R9350:Serpinb13'
ID 707989
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 106995832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 89 (L89*)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably null
Transcript: ENSMUST00000027564
AA Change: L89*
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: L89*

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136766
AA Change: *111R
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: *111R

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 43,569,632 M274L probably benign Het
Adarb1 T A 10: 77,322,433 N60I possibly damaging Het
Adgrv1 T A 13: 81,506,155 N2919I probably damaging Het
Adora3 C T 3: 105,907,297 T121M possibly damaging Het
Arhgap19 A T 19: 41,773,127 F466Y probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atxn7l1 C T 12: 33,367,316 T492I probably benign Het
B3galnt2 T C 13: 13,995,808 S248P probably damaging Het
Casp2 T C 6: 42,269,398 V230A probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctnnbl1 G A 2: 157,809,525 G240E possibly damaging Het
Dennd2c T C 3: 103,131,992 L152P possibly damaging Het
Dhx16 T A 17: 35,889,311 F874Y probably damaging Het
Dnah14 A T 1: 181,734,804 Y2643F possibly damaging Het
Dnah2 C A 11: 69,493,247 V1048L probably benign Het
Dnah7a T C 1: 53,397,148 I4012V probably benign Het
Duox2 G A 2: 122,285,248 R1002* probably null Het
Ears2 T A 7: 122,044,563 K391* probably null Het
Eif4e T C 3: 138,553,709 V176A probably benign Het
Erbb4 T A 1: 68,290,479 I626L probably benign Het
Fam171a1 C T 2: 3,225,000 T390I probably benign Het
Fam187b A G 7: 30,977,612 E182G possibly damaging Het
Fam204a A G 19: 60,221,253 V15A probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Fzd6 A G 15: 39,031,648 D403G probably damaging Het
Gars G A 6: 55,052,264 A210T probably null Het
Gmcl1 A T 6: 86,700,587 I428N probably damaging Het
Gmip T A 8: 69,811,182 I92N probably damaging Het
Il17rc G A 6: 113,479,087 V298I probably damaging Het
Kifap3 A G 1: 163,783,061 I37V probably benign Het
Marf1 T C 16: 14,145,925 K505E probably damaging Het
Masp2 A T 4: 148,607,939 probably null Het
Mmp15 G A 8: 95,366,374 R127H probably damaging Het
Nrd1 A G 4: 109,032,461 T402A possibly damaging Het
Olfr731 T A 14: 50,237,950 I312L probably benign Het
Olfr934 A T 9: 38,982,785 N86K probably benign Het
Papln A T 12: 83,786,864 I1185F probably damaging Het
Pcdhgb1 A G 18: 37,681,652 N399D probably benign Het
Pcdhgb6 T A 18: 37,743,819 S527T probably benign Het
Phkb T A 8: 86,016,864 Y530* probably null Het
Pira2 A G 7: 3,841,031 S581P probably benign Het
Pou4f3 A T 18: 42,395,264 T91S probably benign Het
Prpf38a A G 4: 108,566,915 S296P unknown Het
Rnf213 T C 11: 119,442,149 V2729A Het
Rtl1 G A 12: 109,590,792 Q1538* probably null Het
Sars2 T C 7: 28,747,848 S224P probably damaging Het
Senp8 A G 9: 59,737,822 V17A probably benign Het
Sh3bp2 T A 5: 34,561,109 probably null Het
Shank2 A G 7: 144,407,208 T254A probably benign Het
Smdt1 A T 15: 82,347,303 E12D probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Svs1 A T 6: 48,988,326 N423Y probably damaging Het
Taar2 A G 10: 23,941,447 N295S probably damaging Het
Trim24 A G 6: 37,915,273 Q247R probably damaging Het
Trpc4 T A 3: 54,302,189 N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 D137G probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Vmn1r235 A G 17: 21,261,928 T172A probably benign Het
Vps13d A G 4: 145,155,763 F1087L Het
Xirp2 T C 2: 67,519,309 S3283P probably damaging Het
Zeb2 C A 2: 44,997,146 S633I possibly damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGCAGAAAGTCAAATGGC -3'
(R):5'- AATAGTCCCATGGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCAAATGGCAGTGGGGAC -3'
(R):5'- GCCATTTCTTGGTACCAC -3'
Posted On 2022-04-18