Incidental Mutation 'R9350:Serpinb13'
ID 707989
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HUR7, HURPIN, PI13, headpin
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106908714-106928925 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 106923562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 89 (L89*)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably null
Transcript: ENSMUST00000027564
AA Change: L89*
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: L89*

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136766
AA Change: *111R
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: *111R

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,022,669 (GRCm39) M274L probably benign Het
Adarb1 T A 10: 77,158,267 (GRCm39) N60I possibly damaging Het
Adgrv1 T A 13: 81,654,274 (GRCm39) N2919I probably damaging Het
Adora3 C T 3: 105,814,613 (GRCm39) T121M possibly damaging Het
Aoc1l3 A T 6: 48,965,260 (GRCm39) N423Y probably damaging Het
Arhgap19 A T 19: 41,761,566 (GRCm39) F466Y probably benign Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
Atxn7l1 C T 12: 33,417,315 (GRCm39) T492I probably benign Het
B3galnt2 T C 13: 14,170,393 (GRCm39) S248P probably damaging Het
Casp2 T C 6: 42,246,332 (GRCm39) V230A probably benign Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctnnbl1 G A 2: 157,651,445 (GRCm39) G240E possibly damaging Het
Dennd2c T C 3: 103,039,308 (GRCm39) L152P possibly damaging Het
Dhx16 T A 17: 36,200,203 (GRCm39) F874Y probably damaging Het
Dnah14 A T 1: 181,562,369 (GRCm39) Y2643F possibly damaging Het
Dnah2 C A 11: 69,384,073 (GRCm39) V1048L probably benign Het
Dnah7a T C 1: 53,436,307 (GRCm39) I4012V probably benign Het
Duox2 G A 2: 122,115,729 (GRCm39) R1002* probably null Het
Ears2 T A 7: 121,643,786 (GRCm39) K391* probably null Het
Eif4e T C 3: 138,259,470 (GRCm39) V176A probably benign Het
Erbb4 T A 1: 68,329,638 (GRCm39) I626L probably benign Het
Fam171a1 C T 2: 3,226,037 (GRCm39) T390I probably benign Het
Fam187b A G 7: 30,677,037 (GRCm39) E182G possibly damaging Het
Fam204a A G 19: 60,209,685 (GRCm39) V15A probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Fzd6 A G 15: 38,895,043 (GRCm39) D403G probably damaging Het
Gars1 G A 6: 55,029,249 (GRCm39) A210T probably null Het
Gmcl1 A T 6: 86,677,569 (GRCm39) I428N probably damaging Het
Gmip T A 8: 70,263,832 (GRCm39) I92N probably damaging Het
Il17rc G A 6: 113,456,048 (GRCm39) V298I probably damaging Het
Kifap3 A G 1: 163,610,630 (GRCm39) I37V probably benign Het
Marf1 T C 16: 13,963,789 (GRCm39) K505E probably damaging Het
Masp2 A T 4: 148,692,396 (GRCm39) probably null Het
Mmp15 G A 8: 96,093,002 (GRCm39) R127H probably damaging Het
Nrdc A G 4: 108,889,658 (GRCm39) T402A possibly damaging Het
Or10d1c A T 9: 38,894,081 (GRCm39) N86K probably benign Het
Or4k6 T A 14: 50,475,407 (GRCm39) I312L probably benign Het
Papln A T 12: 83,833,638 (GRCm39) I1185F probably damaging Het
Pcdhgb1 A G 18: 37,814,705 (GRCm39) N399D probably benign Het
Pcdhgb6 T A 18: 37,876,872 (GRCm39) S527T probably benign Het
Phkb T A 8: 86,743,493 (GRCm39) Y530* probably null Het
Pira2 A G 7: 3,844,030 (GRCm39) S581P probably benign Het
Pou4f3 A T 18: 42,528,329 (GRCm39) T91S probably benign Het
Prpf38a A G 4: 108,424,112 (GRCm39) S296P unknown Het
Rnf213 T C 11: 119,332,975 (GRCm39) V2729A Het
Rtl1 G A 12: 109,557,226 (GRCm39) Q1538* probably null Het
Sars2 T C 7: 28,447,273 (GRCm39) S224P probably damaging Het
Senp8 A G 9: 59,645,105 (GRCm39) V17A probably benign Het
Sh3bp2 T A 5: 34,718,453 (GRCm39) probably null Het
Shank2 A G 7: 143,960,945 (GRCm39) T254A probably benign Het
Smdt1 A T 15: 82,231,504 (GRCm39) E12D probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Taar2 A G 10: 23,817,345 (GRCm39) N295S probably damaging Het
Trim24 A G 6: 37,892,208 (GRCm39) Q247R probably damaging Het
Trpc4 T A 3: 54,209,610 (GRCm39) N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 (GRCm38) D137G probably damaging Het
Ubn1 T A 16: 4,899,422 (GRCm39) H1055Q probably benign Het
Vmn1r235 A G 17: 21,482,190 (GRCm39) T172A probably benign Het
Vps13d A G 4: 144,882,333 (GRCm39) F1087L Het
Xirp2 T C 2: 67,349,653 (GRCm39) S3283P probably damaging Het
Zeb2 C A 2: 44,887,158 (GRCm39) S633I possibly damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106,924,110 (GRCm39) missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 106,928,484 (GRCm39) missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106,926,688 (GRCm39) missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106,926,640 (GRCm39) missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106,926,751 (GRCm39) missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 106,928,466 (GRCm39) missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106,909,886 (GRCm39) start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 106,928,157 (GRCm39) missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106,910,568 (GRCm39) missense probably null 0.15
R3418:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106,926,302 (GRCm39) missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106,926,427 (GRCm39) missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106,909,915 (GRCm39) missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106,926,332 (GRCm39) missense probably benign 0.00
R6015:Serpinb13 UTSW 1 106,928,337 (GRCm39) missense probably benign 0.00
R6363:Serpinb13 UTSW 1 106,928,504 (GRCm39) nonsense probably null
R6720:Serpinb13 UTSW 1 106,921,792 (GRCm39) missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106,926,663 (GRCm39) missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106,926,679 (GRCm39) missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 106,928,519 (GRCm39) missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 106,928,165 (GRCm39) missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106,923,519 (GRCm39) missense probably benign 0.01
R9375:Serpinb13 UTSW 1 106,909,997 (GRCm39) missense probably damaging 1.00
R9774:Serpinb13 UTSW 1 106,923,579 (GRCm39) missense probably benign 0.02
Z1177:Serpinb13 UTSW 1 106,910,033 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGCAGAAAGTCAAATGGC -3'
(R):5'- AATAGTCCCATGGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCAAATGGCAGTGGGGAC -3'
(R):5'- GCCATTTCTTGGTACCAC -3'
Posted On 2022-04-18