Incidental Mutation 'R0743:Nol7'
ID70799
Institutional Source Beutler Lab
Gene Symbol Nol7
Ensembl Gene ENSMUSG00000063200
Gene Namenucleolar protein 7
Synonyms5730556I21Rik, 2210008F15Rik, NOP27, RARG-1
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location43398390-43407097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43400615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 133 (V133I)
Ref Sequence ENSEMBL: ENSMUSP00000152581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071926] [ENSMUST00000144326] [ENSMUST00000222499] [ENSMUST00000222651]
Predicted Effect probably benign
Transcript: ENSMUST00000071926
AA Change: V133I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071818
Gene: ENSMUSG00000063200
AA Change: V133I

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
Pfam:NUC129 167 229 1.1e-34 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144326
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220997
Predicted Effect probably benign
Transcript: ENSMUST00000221092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222416
Predicted Effect probably benign
Transcript: ENSMUST00000222499
AA Change: V133I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000222651
Predicted Effect probably benign
Transcript: ENSMUST00000222754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223188
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the nucleolus, where it maintains nucleolar structure and cell growth rates. The encoded protein also functions as a tumor suppressor and regulator of angiogenesis. The RB tumor suppressor gene recruits transcription factors to this gene and positively regulates its expression. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Nol7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01821:Nol7 APN 13 43398740 missense probably benign 0.02
IGL03011:Nol7 APN 13 43401293 unclassified probably benign
R0884:Nol7 UTSW 13 43400615 missense probably benign 0.19
R1480:Nol7 UTSW 13 43398628 missense probably damaging 0.99
R4379:Nol7 UTSW 13 43401575 missense probably damaging 1.00
R5435:Nol7 UTSW 13 43401372 missense possibly damaging 0.54
R7185:Nol7 UTSW 13 43406831 critical splice acceptor site probably null
R7487:Nol7 UTSW 13 43398600 missense probably damaging 1.00
R8052:Nol7 UTSW 13 43401514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATACTGTGAGACTAGCACCAGCC -3'
(R):5'- TCATTACCCGACAGACTGCACTTTC -3'

Sequencing Primer
(F):5'- GTTCTGAGGACACTCCATACTAGTC -3'
(R):5'- GAAGTTACTCACTTTGGTGACCAC -3'
Posted On2013-09-30