Incidental Mutation 'R9350:Fam171a1'
ID 707992
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3225000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 390 (T390I)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: T385I

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: T385I

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: T265I

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: T265I

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: T390I

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: T390I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 43,569,632 M274L probably benign Het
Adarb1 T A 10: 77,322,433 N60I possibly damaging Het
Adgrv1 T A 13: 81,506,155 N2919I probably damaging Het
Adora3 C T 3: 105,907,297 T121M possibly damaging Het
Arhgap19 A T 19: 41,773,127 F466Y probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atxn7l1 C T 12: 33,367,316 T492I probably benign Het
B3galnt2 T C 13: 13,995,808 S248P probably damaging Het
Casp2 T C 6: 42,269,398 V230A probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctnnbl1 G A 2: 157,809,525 G240E possibly damaging Het
Dennd2c T C 3: 103,131,992 L152P possibly damaging Het
Dhx16 T A 17: 35,889,311 F874Y probably damaging Het
Dnah14 A T 1: 181,734,804 Y2643F possibly damaging Het
Dnah2 C A 11: 69,493,247 V1048L probably benign Het
Dnah7a T C 1: 53,397,148 I4012V probably benign Het
Duox2 G A 2: 122,285,248 R1002* probably null Het
Ears2 T A 7: 122,044,563 K391* probably null Het
Eif4e T C 3: 138,553,709 V176A probably benign Het
Erbb4 T A 1: 68,290,479 I626L probably benign Het
Fam187b A G 7: 30,977,612 E182G possibly damaging Het
Fam204a A G 19: 60,221,253 V15A probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Fzd6 A G 15: 39,031,648 D403G probably damaging Het
Gars G A 6: 55,052,264 A210T probably null Het
Gmcl1 A T 6: 86,700,587 I428N probably damaging Het
Gmip T A 8: 69,811,182 I92N probably damaging Het
Il17rc G A 6: 113,479,087 V298I probably damaging Het
Kifap3 A G 1: 163,783,061 I37V probably benign Het
Marf1 T C 16: 14,145,925 K505E probably damaging Het
Masp2 A T 4: 148,607,939 probably null Het
Mmp15 G A 8: 95,366,374 R127H probably damaging Het
Nrd1 A G 4: 109,032,461 T402A possibly damaging Het
Olfr731 T A 14: 50,237,950 I312L probably benign Het
Olfr934 A T 9: 38,982,785 N86K probably benign Het
Papln A T 12: 83,786,864 I1185F probably damaging Het
Pcdhgb1 A G 18: 37,681,652 N399D probably benign Het
Pcdhgb6 T A 18: 37,743,819 S527T probably benign Het
Phkb T A 8: 86,016,864 Y530* probably null Het
Pira2 A G 7: 3,841,031 S581P probably benign Het
Pou4f3 A T 18: 42,395,264 T91S probably benign Het
Prpf38a A G 4: 108,566,915 S296P unknown Het
Rnf213 T C 11: 119,442,149 V2729A Het
Rtl1 G A 12: 109,590,792 Q1538* probably null Het
Sars2 T C 7: 28,747,848 S224P probably damaging Het
Senp8 A G 9: 59,737,822 V17A probably benign Het
Serpinb13 T A 1: 106,995,832 L89* probably null Het
Sh3bp2 T A 5: 34,561,109 probably null Het
Shank2 A G 7: 144,407,208 T254A probably benign Het
Smdt1 A T 15: 82,347,303 E12D probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Svs1 A T 6: 48,988,326 N423Y probably damaging Het
Taar2 A G 10: 23,941,447 N295S probably damaging Het
Trim24 A G 6: 37,915,273 Q247R probably damaging Het
Trpc4 T A 3: 54,302,189 N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 D137G probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Vmn1r235 A G 17: 21,261,928 T172A probably benign Het
Vps13d A G 4: 145,155,763 F1087L Het
Xirp2 T C 2: 67,519,309 S3283P probably damaging Het
Zeb2 C A 2: 44,997,146 S633I possibly damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCCATCATGAGTCTCTCAC -3'
(R):5'- TCCCACTTGGCGTTAAGTTATC -3'

Sequencing Primer
(F):5'- AGGAAGTGCTTGAAACCCC -3'
(R):5'- CCCACTTGGCGTTAAGTTATCAAAAG -3'
Posted On 2022-04-18