Incidental Mutation 'R9350:Mmp15'
ID 708022
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms Membrane type 2-MMP, MT2-MMP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95352268-95375080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 95366374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 127 (R127H)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect probably damaging
Transcript: ENSMUST00000034243
AA Change: R127H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: R127H

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 43,569,632 M274L probably benign Het
Adarb1 T A 10: 77,322,433 N60I possibly damaging Het
Adgrv1 T A 13: 81,506,155 N2919I probably damaging Het
Adora3 C T 3: 105,907,297 T121M possibly damaging Het
Arhgap19 A T 19: 41,773,127 F466Y probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atxn7l1 C T 12: 33,367,316 T492I probably benign Het
B3galnt2 T C 13: 13,995,808 S248P probably damaging Het
Casp2 T C 6: 42,269,398 V230A probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctnnbl1 G A 2: 157,809,525 G240E possibly damaging Het
Dennd2c T C 3: 103,131,992 L152P possibly damaging Het
Dhx16 T A 17: 35,889,311 F874Y probably damaging Het
Dnah14 A T 1: 181,734,804 Y2643F possibly damaging Het
Dnah2 C A 11: 69,493,247 V1048L probably benign Het
Dnah7a T C 1: 53,397,148 I4012V probably benign Het
Duox2 G A 2: 122,285,248 R1002* probably null Het
Ears2 T A 7: 122,044,563 K391* probably null Het
Eif4e T C 3: 138,553,709 V176A probably benign Het
Erbb4 T A 1: 68,290,479 I626L probably benign Het
Fam171a1 C T 2: 3,225,000 T390I probably benign Het
Fam187b A G 7: 30,977,612 E182G possibly damaging Het
Fam204a A G 19: 60,221,253 V15A probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Fzd6 A G 15: 39,031,648 D403G probably damaging Het
Gars G A 6: 55,052,264 A210T probably null Het
Gmcl1 A T 6: 86,700,587 I428N probably damaging Het
Gmip T A 8: 69,811,182 I92N probably damaging Het
Il17rc G A 6: 113,479,087 V298I probably damaging Het
Kifap3 A G 1: 163,783,061 I37V probably benign Het
Marf1 T C 16: 14,145,925 K505E probably damaging Het
Masp2 A T 4: 148,607,939 probably null Het
Nrd1 A G 4: 109,032,461 T402A possibly damaging Het
Olfr731 T A 14: 50,237,950 I312L probably benign Het
Olfr934 A T 9: 38,982,785 N86K probably benign Het
Papln A T 12: 83,786,864 I1185F probably damaging Het
Pcdhgb1 A G 18: 37,681,652 N399D probably benign Het
Pcdhgb6 T A 18: 37,743,819 S527T probably benign Het
Phkb T A 8: 86,016,864 Y530* probably null Het
Pira2 A G 7: 3,841,031 S581P probably benign Het
Pou4f3 A T 18: 42,395,264 T91S probably benign Het
Prpf38a A G 4: 108,566,915 S296P unknown Het
Rnf213 T C 11: 119,442,149 V2729A Het
Rtl1 G A 12: 109,590,792 Q1538* probably null Het
Sars2 T C 7: 28,747,848 S224P probably damaging Het
Senp8 A G 9: 59,737,822 V17A probably benign Het
Serpinb13 T A 1: 106,995,832 L89* probably null Het
Sh3bp2 T A 5: 34,561,109 probably null Het
Shank2 A G 7: 144,407,208 T254A probably benign Het
Smdt1 A T 15: 82,347,303 E12D probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Svs1 A T 6: 48,988,326 N423Y probably damaging Het
Taar2 A G 10: 23,941,447 N295S probably damaging Het
Trim24 A G 6: 37,915,273 Q247R probably damaging Het
Trpc4 T A 3: 54,302,189 N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 D137G probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Vmn1r235 A G 17: 21,261,928 T172A probably benign Het
Vps13d A G 4: 145,155,763 F1087L Het
Xirp2 T C 2: 67,519,309 S3283P probably damaging Het
Zeb2 C A 2: 44,997,146 S633I possibly damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
R8679:Mmp15 UTSW 8 95366354 missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 95369660 nonsense probably null
R9028:Mmp15 UTSW 8 95369688 missense probably benign 0.01
R9227:Mmp15 UTSW 8 95366331 missense probably benign 0.06
R9230:Mmp15 UTSW 8 95366331 missense probably benign 0.06
R9632:Mmp15 UTSW 8 95372103 critical splice acceptor site probably null
R9695:Mmp15 UTSW 8 95370786 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGAATCTCTTTACCCACTATTCTGG -3'
(R):5'- ACACGTGACAGTGACCCATC -3'

Sequencing Primer
(F):5'- TGGAAGCCAGAGTCTCCCAC -3'
(R):5'- AGTGACCCATCTTTCCCTGGAG -3'
Posted On 2022-04-18