Incidental Mutation 'R9350:Olfr934'
ID 708023
Institutional Source Beutler Lab
Gene Symbol Olfr934
Ensembl Gene ENSMUSG00000057424
Gene Name olfactory receptor 934
Synonyms MOR224-6, GA_x6K02T2PVTD-32678895-32677963
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 38981026-38988315 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38982785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 86 (N86K)
Ref Sequence ENSEMBL: ENSMUSP00000150864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074211] [ENSMUST00000214324] [ENSMUST00000216238] [ENSMUST00000216823]
AlphaFold Q9EQ87
Predicted Effect probably benign
Transcript: ENSMUST00000074211
AA Change: N86K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073835
Gene: ENSMUSG00000057424
AA Change: N86K

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 222 7.2e-9 PFAM
Pfam:7tm_1 39 286 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214324
AA Change: N86K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216238
Predicted Effect probably benign
Transcript: ENSMUST00000216823
AA Change: N86K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 43,569,632 M274L probably benign Het
Adarb1 T A 10: 77,322,433 N60I possibly damaging Het
Adgrv1 T A 13: 81,506,155 N2919I probably damaging Het
Adora3 C T 3: 105,907,297 T121M possibly damaging Het
Arhgap19 A T 19: 41,773,127 F466Y probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atxn7l1 C T 12: 33,367,316 T492I probably benign Het
B3galnt2 T C 13: 13,995,808 S248P probably damaging Het
Casp2 T C 6: 42,269,398 V230A probably benign Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctnnbl1 G A 2: 157,809,525 G240E possibly damaging Het
Dennd2c T C 3: 103,131,992 L152P possibly damaging Het
Dhx16 T A 17: 35,889,311 F874Y probably damaging Het
Dnah14 A T 1: 181,734,804 Y2643F possibly damaging Het
Dnah2 C A 11: 69,493,247 V1048L probably benign Het
Dnah7a T C 1: 53,397,148 I4012V probably benign Het
Duox2 G A 2: 122,285,248 R1002* probably null Het
Ears2 T A 7: 122,044,563 K391* probably null Het
Eif4e T C 3: 138,553,709 V176A probably benign Het
Erbb4 T A 1: 68,290,479 I626L probably benign Het
Fam171a1 C T 2: 3,225,000 T390I probably benign Het
Fam187b A G 7: 30,977,612 E182G possibly damaging Het
Fam204a A G 19: 60,221,253 V15A probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Fzd6 A G 15: 39,031,648 D403G probably damaging Het
Gars G A 6: 55,052,264 A210T probably null Het
Gmcl1 A T 6: 86,700,587 I428N probably damaging Het
Gmip T A 8: 69,811,182 I92N probably damaging Het
Il17rc G A 6: 113,479,087 V298I probably damaging Het
Kifap3 A G 1: 163,783,061 I37V probably benign Het
Marf1 T C 16: 14,145,925 K505E probably damaging Het
Masp2 A T 4: 148,607,939 probably null Het
Mmp15 G A 8: 95,366,374 R127H probably damaging Het
Nrd1 A G 4: 109,032,461 T402A possibly damaging Het
Olfr731 T A 14: 50,237,950 I312L probably benign Het
Papln A T 12: 83,786,864 I1185F probably damaging Het
Pcdhgb1 A G 18: 37,681,652 N399D probably benign Het
Pcdhgb6 T A 18: 37,743,819 S527T probably benign Het
Phkb T A 8: 86,016,864 Y530* probably null Het
Pira2 A G 7: 3,841,031 S581P probably benign Het
Pou4f3 A T 18: 42,395,264 T91S probably benign Het
Prpf38a A G 4: 108,566,915 S296P unknown Het
Rnf213 T C 11: 119,442,149 V2729A Het
Rtl1 G A 12: 109,590,792 Q1538* probably null Het
Sars2 T C 7: 28,747,848 S224P probably damaging Het
Senp8 A G 9: 59,737,822 V17A probably benign Het
Serpinb13 T A 1: 106,995,832 L89* probably null Het
Sh3bp2 T A 5: 34,561,109 probably null Het
Shank2 A G 7: 144,407,208 T254A probably benign Het
Smdt1 A T 15: 82,347,303 E12D probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Svs1 A T 6: 48,988,326 N423Y probably damaging Het
Taar2 A G 10: 23,941,447 N295S probably damaging Het
Trim24 A G 6: 37,915,273 Q247R probably damaging Het
Trpc4 T A 3: 54,302,189 N658K probably damaging Het
Ube2e1 T C 14: 18,284,348 D137G probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Vmn1r235 A G 17: 21,261,928 T172A probably benign Het
Vps13d A G 4: 145,155,763 F1087L Het
Xirp2 T C 2: 67,519,309 S3283P probably damaging Het
Zeb2 C A 2: 44,997,146 S633I possibly damaging Het
Other mutations in Olfr934
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Olfr934 APN 9 38982546 missense possibly damaging 0.71
R1061:Olfr934 UTSW 9 38982483 missense probably damaging 1.00
R1604:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R1776:Olfr934 UTSW 9 38982894 missense probably damaging 1.00
R3499:Olfr934 UTSW 9 38982465 missense probably damaging 1.00
R3761:Olfr934 UTSW 9 38982366 missense possibly damaging 0.94
R3876:Olfr934 UTSW 9 38982870 missense probably damaging 1.00
R4191:Olfr934 UTSW 9 38983017 missense probably benign 0.01
R4192:Olfr934 UTSW 9 38983017 missense probably benign 0.01
R4333:Olfr934 UTSW 9 38982588 missense possibly damaging 0.85
R4876:Olfr934 UTSW 9 38982626 nonsense probably null
R5539:Olfr934 UTSW 9 38982277 missense possibly damaging 0.85
R6916:Olfr934 UTSW 9 38982904 missense probably benign 0.14
R7097:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R7338:Olfr934 UTSW 9 38982520 missense probably damaging 0.99
R8116:Olfr934 UTSW 9 38982873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTAGCCTGAATGCAGCC -3'
(R):5'- GGAGATCATGCTCTTTGTCCTG -3'

Sequencing Primer
(F):5'- TGATGTCCCCACAGCCATGATG -3'
(R):5'- AGATCATGCTCTTTGTCCTGTTTTTG -3'
Posted On 2022-04-18