Mutagenetix > Incidental Mutation

Incidental Mutation 'R9350:Rnf213'

708029

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119283926-119378244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119332975 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2729 (V2729A)

Ref Sequence

ENSEMBL: ENSMUSP00000091429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: V2729A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: V2728A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: V2728A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	T	A	8: 44,022,669 (GRCm39)	M274L	probably benign	Het
Adarb1	T	A	10: 77,158,267 (GRCm39)	N60I	possibly damaging	Het
Adgrv1	T	A	13: 81,654,274 (GRCm39)	N2919I	probably damaging	Het
Adora3	C	T	3: 105,814,613 (GRCm39)	T121M	possibly damaging	Het
Aoc1l3	A	T	6: 48,965,260 (GRCm39)	N423Y	probably damaging	Het
Arhgap19	A	T	19: 41,761,566 (GRCm39)	F466Y	probably benign	Het
Arih2	C	G	9: 108,488,938 (GRCm39)	R260P	probably damaging	Het
Atxn7l1	C	T	12: 33,417,315 (GRCm39)	T492I	probably benign	Het
B3galnt2	T	C	13: 14,170,393 (GRCm39)	S248P	probably damaging	Het
Casp2	T	C	6: 42,246,332 (GRCm39)	V230A	probably benign	Het
Creb3l1	C	T	2: 91,822,231 (GRCm39)		probably null	Het
Ctnnbl1	G	A	2: 157,651,445 (GRCm39)	G240E	possibly damaging	Het
Dennd2c	T	C	3: 103,039,308 (GRCm39)	L152P	possibly damaging	Het
Dhx16	T	A	17: 36,200,203 (GRCm39)	F874Y	probably damaging	Het
Dnah14	A	T	1: 181,562,369 (GRCm39)	Y2643F	possibly damaging	Het
Dnah2	C	A	11: 69,384,073 (GRCm39)	V1048L	probably benign	Het
Dnah7a	T	C	1: 53,436,307 (GRCm39)	I4012V	probably benign	Het
Duox2	G	A	2: 122,115,729 (GRCm39)	R1002*	probably null	Het
Ears2	T	A	7: 121,643,786 (GRCm39)	K391*	probably null	Het
Eif4e	T	C	3: 138,259,470 (GRCm39)	V176A	probably benign	Het
Erbb4	T	A	1: 68,329,638 (GRCm39)	I626L	probably benign	Het
Fam171a1	C	T	2: 3,226,037 (GRCm39)	T390I	probably benign	Het
Fam187b	A	G	7: 30,677,037 (GRCm39)	E182G	possibly damaging	Het
Fam204a	A	G	19: 60,209,685 (GRCm39)	V15A	probably benign	Het
Fscn3	C	T	6: 28,430,432 (GRCm39)	R201*	probably null	Het
Fzd6	A	G	15: 38,895,043 (GRCm39)	D403G	probably damaging	Het
Gars1	G	A	6: 55,029,249 (GRCm39)	A210T	probably null	Het
Gmcl1	A	T	6: 86,677,569 (GRCm39)	I428N	probably damaging	Het
Gmip	T	A	8: 70,263,832 (GRCm39)	I92N	probably damaging	Het
Il17rc	G	A	6: 113,456,048 (GRCm39)	V298I	probably damaging	Het
Kifap3	A	G	1: 163,610,630 (GRCm39)	I37V	probably benign	Het
Marf1	T	C	16: 13,963,789 (GRCm39)	K505E	probably damaging	Het
Masp2	A	T	4: 148,692,396 (GRCm39)		probably null	Het
Mmp15	G	A	8: 96,093,002 (GRCm39)	R127H	probably damaging	Het
Nrdc	A	G	4: 108,889,658 (GRCm39)	T402A	possibly damaging	Het
Or10d1c	A	T	9: 38,894,081 (GRCm39)	N86K	probably benign	Het
Or4k6	T	A	14: 50,475,407 (GRCm39)	I312L	probably benign	Het
Papln	A	T	12: 83,833,638 (GRCm39)	I1185F	probably damaging	Het
Pcdhgb1	A	G	18: 37,814,705 (GRCm39)	N399D	probably benign	Het
Pcdhgb6	T	A	18: 37,876,872 (GRCm39)	S527T	probably benign	Het
Phkb	T	A	8: 86,743,493 (GRCm39)	Y530*	probably null	Het
Pira2	A	G	7: 3,844,030 (GRCm39)	S581P	probably benign	Het
Pou4f3	A	T	18: 42,528,329 (GRCm39)	T91S	probably benign	Het
Prpf38a	A	G	4: 108,424,112 (GRCm39)	S296P	unknown	Het
Rtl1	G	A	12: 109,557,226 (GRCm39)	Q1538*	probably null	Het
Sars2	T	C	7: 28,447,273 (GRCm39)	S224P	probably damaging	Het
Senp8	A	G	9: 59,645,105 (GRCm39)	V17A	probably benign	Het
Serpinb13	T	A	1: 106,923,562 (GRCm39)	L89*	probably null	Het
Sh3bp2	T	A	5: 34,718,453 (GRCm39)		probably null	Het
Shank2	A	G	7: 143,960,945 (GRCm39)	T254A	probably benign	Het
Smdt1	A	T	15: 82,231,504 (GRCm39)	E12D	probably benign	Het
Sp110	G	A	1: 85,506,813 (GRCm39)	R417C	probably benign	Het
Taar2	A	G	10: 23,817,345 (GRCm39)	N295S	probably damaging	Het
Trim24	A	G	6: 37,892,208 (GRCm39)	Q247R	probably damaging	Het
Trpc4	T	A	3: 54,209,610 (GRCm39)	N658K	probably damaging	Het
Ube2e1	T	C	14: 18,284,348 (GRCm38)	D137G	probably damaging	Het
Ubn1	T	A	16: 4,899,422 (GRCm39)	H1055Q	probably benign	Het
Vmn1r235	A	G	17: 21,482,190 (GRCm39)	T172A	probably benign	Het
Vps13d	A	G	4: 144,882,333 (GRCm39)	F1087L		Het
Xirp2	T	C	2: 67,349,653 (GRCm39)	S3283P	probably damaging	Het
Zeb2	C	A	2: 44,887,158 (GRCm39)	S633I	possibly damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,340,169 (GRCm39)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,331,669 (GRCm39)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,338,063 (GRCm39)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,373,944 (GRCm39)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,334,126 (GRCm39)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,340,702 (GRCm39)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,327,178 (GRCm39)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,332,133 (GRCm39)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,333,092 (GRCm39)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,333,841 (GRCm39)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,307,283 (GRCm39)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,334,094 (GRCm39)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,309,135 (GRCm39)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,336,499 (GRCm39)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,331,476 (GRCm39)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,371,733 (GRCm39)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,354,162 (GRCm39)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,327,628 (GRCm39)	missense	probably benign
IGL02588:Rnf213	APN	11	119,307,362 (GRCm39)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,331,615 (GRCm39)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,325,892 (GRCm39)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,318,336 (GRCm39)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,370,767 (GRCm39)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,336,452 (GRCm39)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,331,913 (GRCm39)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,355,833 (GRCm39)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,364,998 (GRCm39)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,333,830 (GRCm39)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,312,294 (GRCm39)	missense	probably benign	0.34
attrition	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
defame	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
Derogate	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
dinky	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,325,568 (GRCm39)	missense
Impugn	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,316,895 (GRCm39)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
PIT4585001:Rnf213	UTSW	11	119,349,218 (GRCm39)	missense
R0008:Rnf213	UTSW	11	119,355,878 (GRCm39)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,332,432 (GRCm39)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,293,401 (GRCm39)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,305,413 (GRCm39)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,307,322 (GRCm39)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,370,426 (GRCm39)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,305,347 (GRCm39)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,328,931 (GRCm39)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,316,937 (GRCm39)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,338,083 (GRCm39)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,316,838 (GRCm39)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,333,946 (GRCm39)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,355,908 (GRCm39)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,334,106 (GRCm39)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,322,543 (GRCm39)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,332,660 (GRCm39)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,331,976 (GRCm39)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,331,894 (GRCm39)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,364,306 (GRCm39)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,313,921 (GRCm39)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,321,312 (GRCm39)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,305,396 (GRCm39)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,307,389 (GRCm39)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,343,407 (GRCm39)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,376,824 (GRCm39)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,368,055 (GRCm39)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,326,809 (GRCm39)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,327,003 (GRCm39)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,326,831 (GRCm39)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,333,226 (GRCm39)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,328,576 (GRCm39)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,371,715 (GRCm39)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,332,714 (GRCm39)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,333,533 (GRCm39)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,332,665 (GRCm39)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,305,352 (GRCm39)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,327,437 (GRCm39)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,354,171 (GRCm39)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,333,405 (GRCm39)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,328,498 (GRCm39)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,331,047 (GRCm39)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,332,009 (GRCm39)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,340,955 (GRCm39)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,307,274 (GRCm39)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,322,511 (GRCm39)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,371,721 (GRCm39)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,331,933 (GRCm39)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,326,848 (GRCm39)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,352,744 (GRCm39)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,358,128 (GRCm39)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,333,489 (GRCm39)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,318,839 (GRCm39)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,341,027 (GRCm39)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,334,516 (GRCm39)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,306,019 (GRCm39)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,305,896 (GRCm39)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,350,835 (GRCm39)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,327,254 (GRCm39)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,305,430 (GRCm39)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,334,021 (GRCm39)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,350,764 (GRCm39)	splice site	probably null
R2698:Rnf213	UTSW	11	119,300,970 (GRCm39)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,359,718 (GRCm39)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,332,802 (GRCm39)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,370,384 (GRCm39)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R4014:Rnf213	UTSW	11	119,336,555 (GRCm39)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,373,274 (GRCm39)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,373,832 (GRCm39)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,300,308 (GRCm39)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,332,069 (GRCm39)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,374,790 (GRCm39)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,370,496 (GRCm39)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,328,521 (GRCm39)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,331,951 (GRCm39)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,331,175 (GRCm39)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,336,571 (GRCm39)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,307,455 (GRCm39)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,333,589 (GRCm39)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,372,066 (GRCm39)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,318,983 (GRCm39)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,327,590 (GRCm39)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,301,633 (GRCm39)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,349,692 (GRCm39)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,331,642 (GRCm39)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,331,634 (GRCm39)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,299,846 (GRCm39)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,305,902 (GRCm39)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,324,325 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,731 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,455 (GRCm39)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,349,611 (GRCm39)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,325,512 (GRCm39)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,374,720 (GRCm39)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,327,121 (GRCm39)	missense	probably benign
R5861:Rnf213	UTSW	11	119,364,203 (GRCm39)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,312,195 (GRCm39)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,333,905 (GRCm39)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,376,836 (GRCm39)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,332,927 (GRCm39)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,307,385 (GRCm39)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,302,339 (GRCm39)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,302,296 (GRCm39)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,332,854 (GRCm39)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,326,825 (GRCm39)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,349,254 (GRCm39)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,305,374 (GRCm39)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,354,192 (GRCm39)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,367,904 (GRCm39)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,350,792 (GRCm39)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,343,513 (GRCm39)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,327,106 (GRCm39)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,370,746 (GRCm39)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,333,097 (GRCm39)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,353,111 (GRCm39)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,339,664 (GRCm39)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,340,692 (GRCm39)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,370,481 (GRCm39)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,328,430 (GRCm39)	splice site	probably null
R7170:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7185:Rnf213	UTSW	11	119,315,024 (GRCm39)	missense
R7239:Rnf213	UTSW	11	119,349,614 (GRCm39)	missense
R7258:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7259:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7260:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7273:Rnf213	UTSW	11	119,322,582 (GRCm39)	splice site	probably null
R7282:Rnf213	UTSW	11	119,328,818 (GRCm39)	missense
R7311:Rnf213	UTSW	11	119,307,373 (GRCm39)	missense
R7352:Rnf213	UTSW	11	119,334,405 (GRCm39)	missense
R7369:Rnf213	UTSW	11	119,321,294 (GRCm39)	missense
R7410:Rnf213	UTSW	11	119,325,877 (GRCm39)	missense
R7448:Rnf213	UTSW	11	119,372,117 (GRCm39)	missense
R7561:Rnf213	UTSW	11	119,332,545 (GRCm39)	missense
R7573:Rnf213	UTSW	11	119,349,310 (GRCm39)	missense
R7615:Rnf213	UTSW	11	119,358,123 (GRCm39)	missense
R7680:Rnf213	UTSW	11	119,370,382 (GRCm39)	missense
R7739:Rnf213	UTSW	11	119,301,687 (GRCm39)	missense
R7789:Rnf213	UTSW	11	119,361,045 (GRCm39)	splice site	probably null
R7806:Rnf213	UTSW	11	119,302,371 (GRCm39)	missense
R8031:Rnf213	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,332,480 (GRCm39)	missense
R8053:Rnf213	UTSW	11	119,293,473 (GRCm39)	missense
R8284:Rnf213	UTSW	11	119,318,909 (GRCm39)	missense
R8301:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
R8325:Rnf213	UTSW	11	119,321,271 (GRCm39)	missense
R8332:Rnf213	UTSW	11	119,374,524 (GRCm39)	missense
R8443:Rnf213	UTSW	11	119,340,149 (GRCm39)	missense
R8518:Rnf213	UTSW	11	119,353,043 (GRCm39)	missense
R8531:Rnf213	UTSW	11	119,365,031 (GRCm39)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,349,563 (GRCm39)	missense
R8675:Rnf213	UTSW	11	119,346,984 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,332,038 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,308,955 (GRCm39)	missense
R8714:Rnf213	UTSW	11	119,359,720 (GRCm39)	missense
R8802:Rnf213	UTSW	11	119,352,928 (GRCm39)	missense
R8861:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense
R8886:Rnf213	UTSW	11	119,364,264 (GRCm39)	missense
R8893:Rnf213	UTSW	11	119,333,868 (GRCm39)	missense
R8937:Rnf213	UTSW	11	119,321,100 (GRCm39)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,305,250 (GRCm39)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,352,756 (GRCm39)	missense
R8983:Rnf213	UTSW	11	119,321,175 (GRCm39)	missense
R9043:Rnf213	UTSW	11	119,349,739 (GRCm39)	missense
R9081:Rnf213	UTSW	11	119,357,062 (GRCm39)	missense
R9132:Rnf213	UTSW	11	119,374,742 (GRCm39)	missense
R9135:Rnf213	UTSW	11	119,299,573 (GRCm39)	missense
R9146:Rnf213	UTSW	11	119,334,499 (GRCm39)	missense
R9156:Rnf213	UTSW	11	119,331,574 (GRCm39)	missense
R9183:Rnf213	UTSW	11	119,318,448 (GRCm39)	missense
R9234:Rnf213	UTSW	11	119,340,943 (GRCm39)	missense
R9275:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9278:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9296:Rnf213	UTSW	11	119,334,621 (GRCm39)	splice site	probably benign
R9366:Rnf213	UTSW	11	119,327,057 (GRCm39)	missense
R9413:Rnf213	UTSW	11	119,357,059 (GRCm39)	missense
R9444:Rnf213	UTSW	11	119,325,623 (GRCm39)	missense
R9464:Rnf213	UTSW	11	119,354,406 (GRCm39)	missense
R9605:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R9649:Rnf213	UTSW	11	119,370,457 (GRCm39)	missense
R9651:Rnf213	UTSW	11	119,331,238 (GRCm39)	missense
R9664:Rnf213	UTSW	11	119,332,794 (GRCm39)	missense
R9696:Rnf213	UTSW	11	119,359,806 (GRCm39)	missense
R9710:Rnf213	UTSW	11	119,331,831 (GRCm39)	missense
R9797:Rnf213	UTSW	11	119,333,365 (GRCm39)	missense
S24628:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,332,650 (GRCm39)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,364,339 (GRCm39)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,331,289 (GRCm39)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,368,080 (GRCm39)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,373,824 (GRCm39)	missense
Z1176:Rnf213	UTSW	11	119,332,236 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TTAGAAGAGAAAGCATCCTACCGC -3'
(R):5'- TCCTTACCCTGCTGGAATCG -3'

Sequencing Primer
(F):5'- GCCAGGTGCTTTCCCAAAC -3'
(R):5'- TGGAATCGAGCGCACTG -3'

Posted On

2022-04-18