Incidental Mutation 'R0743:Tmem39a'
ID70806
Institutional Source Beutler Lab
Gene Symbol Tmem39a
Ensembl Gene ENSMUSG00000002845
Gene Nametransmembrane protein 39a
Synonyms
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38558698-38592162 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38585402 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 200 (I200F)
Ref Sequence ENSEMBL: ENSMUSP00000126218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002924] [ENSMUST00000163133] [ENSMUST00000163884] [ENSMUST00000163948] [ENSMUST00000171687]
Predicted Effect probably damaging
Transcript: ENSMUST00000002924
AA Change: I268F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002924
Gene: ENSMUSG00000002845
AA Change: I268F

DomainStartEndE-ValueType
Pfam:Tmp39 40 476 9.4e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163133
SMART Domains Protein: ENSMUSP00000130122
Gene: ENSMUSG00000002845

DomainStartEndE-ValueType
low complexity region 26 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163549
Predicted Effect probably damaging
Transcript: ENSMUST00000163884
AA Change: I268F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132515
Gene: ENSMUSG00000002845
AA Change: I268F

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
Pfam:Tmp39 42 475 1.3e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163948
AA Change: I114F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130791
Gene: ENSMUSG00000002845
AA Change: I114F

DomainStartEndE-ValueType
low complexity region 26 34 N/A INTRINSIC
Pfam:Tmp39 35 164 7.1e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165140
Predicted Effect probably benign
Transcript: ENSMUST00000165631
SMART Domains Protein: ENSMUSP00000130186
Gene: ENSMUSG00000002845

DomainStartEndE-ValueType
Pfam:Tmp39 1 101 9.7e-49 PFAM
Pfam:Tmp39 99 134 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166854
SMART Domains Protein: ENSMUSP00000127040
Gene: ENSMUSG00000002845

DomainStartEndE-ValueType
Pfam:Tmp39 1 152 4.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167033
Predicted Effect unknown
Transcript: ENSMUST00000169554
AA Change: I81F
SMART Domains Protein: ENSMUSP00000127143
Gene: ENSMUSG00000002845
AA Change: I81F

DomainStartEndE-ValueType
Pfam:Tmp39 1 190 2.2e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171064
Predicted Effect probably damaging
Transcript: ENSMUST00000171687
AA Change: I200F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126218
Gene: ENSMUSG00000002845
AA Change: I200F

DomainStartEndE-ValueType
Pfam:Tmp39 40 192 4.4e-62 PFAM
Pfam:Tmp39 193 408 4.2e-119 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Tmem39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03276:Tmem39a APN 16 38585284 missense probably benign 0.01
R0270:Tmem39a UTSW 16 38564313 splice site probably benign
R0382:Tmem39a UTSW 16 38591398 utr 3 prime probably benign
R0539:Tmem39a UTSW 16 38590975 missense probably benign 0.00
R1324:Tmem39a UTSW 16 38573169 missense possibly damaging 0.84
R4052:Tmem39a UTSW 16 38586288 missense probably damaging 1.00
R4799:Tmem39a UTSW 16 38591162 utr 3 prime probably benign
R4919:Tmem39a UTSW 16 38585199 missense probably benign
R5109:Tmem39a UTSW 16 38590964 missense probably damaging 0.99
R5901:Tmem39a UTSW 16 38573206 missense probably benign 0.00
R5978:Tmem39a UTSW 16 38591030 missense probably benign 0.12
R5979:Tmem39a UTSW 16 38575744 missense probably damaging 0.99
R6375:Tmem39a UTSW 16 38585237 missense probably benign 0.00
R7357:Tmem39a UTSW 16 38586230 missense probably damaging 1.00
R7485:Tmem39a UTSW 16 38588296 missense possibly damaging 0.51
R8114:Tmem39a UTSW 16 38590996 missense probably damaging 1.00
R8114:Tmem39a UTSW 16 38590997 missense probably damaging 1.00
Z1088:Tmem39a UTSW 16 38575778 missense possibly damaging 0.69
Z1176:Tmem39a UTSW 16 38588224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGGTTCAGCACCAGGCAGTAG -3'
(R):5'- GGGACACTAAAATGGCCCAACGTG -3'

Sequencing Primer
(F):5'- TAGAGGAGGCGGCTTCAAATG -3'
(R):5'- TGCACTCCAGATGCAGC -3'
Posted On2013-09-30