Incidental Mutation 'R9351:Vmn2r26'
ID 708062
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9351 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124016333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 266 (M266L)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: M266L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M266L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,066,068 (GRCm39) T84A probably benign Het
Abca17 G A 17: 24,510,751 (GRCm39) S909L probably benign Het
Adamtsl3 A T 7: 82,169,929 (GRCm39) Y371F possibly damaging Het
Adcy9 A T 16: 4,236,228 (GRCm39) S394R probably damaging Het
Ahcyl1 T C 3: 107,575,011 (GRCm39) N444S probably damaging Het
Ahnak A C 19: 8,985,232 (GRCm39) D2172A probably damaging Het
Arhgef28 C T 13: 98,130,576 (GRCm39) D421N probably benign Het
Brd1 T A 15: 88,614,307 (GRCm39) E196V possibly damaging Het
Cabs1 A G 5: 88,128,300 (GRCm39) D317G probably damaging Het
Ccdc96 T C 5: 36,642,069 (GRCm39) I25T unknown Het
Clgn A G 8: 84,153,218 (GRCm39) R607G possibly damaging Het
Clp1 T C 2: 84,554,195 (GRCm39) K325E probably benign Het
Dcun1d1 A T 3: 35,975,185 (GRCm39) I52K probably benign Het
Dync2h1 G A 9: 7,176,911 (GRCm39) T16I probably damaging Het
Eif4a3l1 A T 6: 136,306,771 (GRCm39) I411F probably benign Het
Epb41l5 A G 1: 119,477,639 (GRCm39) F711L probably benign Het
Esr1 G A 10: 4,696,763 (GRCm39) W204* probably null Het
Fat2 A G 11: 55,172,127 (GRCm39) L2862P probably damaging Het
Frmd3 A G 4: 74,054,068 (GRCm39) E159G probably damaging Het
Gsto2 T A 19: 47,874,608 (GRCm39) C243S possibly damaging Het
Heg1 A G 16: 33,545,867 (GRCm39) H206R probably benign Het
Ifi203 A G 1: 173,750,133 (GRCm39) V862A probably benign Het
Ippk C T 13: 49,615,107 (GRCm39) H497Y probably benign Het
Irf5 A T 6: 29,531,317 (GRCm39) N61I possibly damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Kcnj12 C T 11: 60,960,673 (GRCm39) H324Y probably damaging Het
Kdm2a C T 19: 4,393,141 (GRCm39) D405N Het
Lars2 A G 9: 123,265,366 (GRCm39) Q474R probably benign Het
Lctl T C 9: 64,040,473 (GRCm39) F472S possibly damaging Het
Map4k2 T C 19: 6,401,223 (GRCm39) S590P probably benign Het
Mcf2l G T 8: 13,050,757 (GRCm39) L337F possibly damaging Het
Mvp A G 7: 126,595,435 (GRCm39) V225A probably damaging Het
Nfat5 T A 8: 108,065,910 (GRCm39) D241E probably damaging Het
Or6n2 T A 1: 173,897,021 (GRCm39) D52E probably benign Het
Pagr1a A T 7: 126,616,073 (GRCm39) H7Q probably damaging Het
Parp8 G T 13: 117,000,781 (GRCm39) Q787K probably damaging Het
Pcdhb2 C A 18: 37,429,369 (GRCm39) N90K probably damaging Het
Pde6h A G 6: 136,936,332 (GRCm39) K25R probably benign Het
Prr35 G A 17: 26,166,118 (GRCm39) Q390* probably null Het
Psd3 C A 8: 68,413,301 (GRCm39) A410S probably benign Het
Pus10 A G 11: 23,617,311 (GRCm39) N8S probably benign Het
Rnf115 T C 3: 96,695,994 (GRCm39) L260S probably damaging Het
Sdsl A T 5: 120,601,159 (GRCm39) Y38N probably benign Het
Sf1 A G 19: 6,415,694 (GRCm39) D11G probably damaging Het
Stxbp5l A G 16: 36,936,047 (GRCm39) Y1177H probably damaging Het
Taar2 G A 10: 23,816,900 (GRCm39) V147I probably benign Het
Tmed3 A T 9: 89,584,980 (GRCm39) F92I possibly damaging Het
Tmprss15 T C 16: 78,832,086 (GRCm39) T357A probably damaging Het
Trbv14 A T 6: 41,112,428 (GRCm39) D75V probably damaging Het
Vmn1r30 A G 6: 58,412,262 (GRCm39) V190A probably benign Het
Vmn2r115 A T 17: 23,578,482 (GRCm39) I652F probably benign Het
Wdr17 T C 8: 55,143,057 (GRCm39) I198V probably benign Het
Wdr27 G A 17: 15,128,833 (GRCm39) A540V possibly damaging Het
Zfp26 A C 9: 20,349,447 (GRCm39) Y372* probably null Het
Zfp286 A G 11: 62,670,801 (GRCm39) V424A probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTATCAGTTTTCAATGCACACCG -3'
(R):5'- AATGATAATCCTCCACCAAAGTGTG -3'

Sequencing Primer
(F):5'- CAGCTCTGTATCAGGGAATTGTCC -3'
(R):5'- CAGAAGTTGTGATCCAGAC -3'
Posted On 2022-04-18