Incidental Mutation 'R9351:Vmn2r26'
ID 708062
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9351 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124039374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 266 (M266L)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: M266L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M266L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,206 T84A probably benign Het
A930017K11Rik G A 17: 25,947,144 Q390* probably null Het
Abca17 G A 17: 24,291,777 S909L probably benign Het
Adamtsl3 A T 7: 82,520,721 Y371F possibly damaging Het
Adcy9 A T 16: 4,418,364 S394R probably damaging Het
Ahcyl1 T C 3: 107,667,695 N444S probably damaging Het
Ahnak A C 19: 9,007,868 D2172A probably damaging Het
Arhgef28 C T 13: 97,994,068 D421N probably benign Het
Brd1 T A 15: 88,730,104 E196V possibly damaging Het
Cabs1 A G 5: 87,980,441 D317G probably damaging Het
Ccdc96 T C 5: 36,484,725 I25T unknown Het
Clgn A G 8: 83,426,589 R607G possibly damaging Het
Clp1 T C 2: 84,723,851 K325E probably benign Het
Dcun1d1 A T 3: 35,921,036 I52K probably benign Het
Dync2h1 G A 9: 7,176,911 T16I probably damaging Het
Epb41l5 A G 1: 119,549,909 F711L probably benign Het
Esr1 G A 10: 4,746,763 W204* probably null Het
Fat2 A G 11: 55,281,301 L2862P probably damaging Het
Frmd3 A G 4: 74,135,831 E159G probably damaging Het
Gm8994 A T 6: 136,329,773 I411F probably benign Het
Gsto2 T A 19: 47,886,169 C243S possibly damaging Het
Heg1 A G 16: 33,725,497 H206R probably benign Het
Ifi203 A G 1: 173,922,567 V862A probably benign Het
Ippk C T 13: 49,461,631 H497Y probably benign Het
Irf5 A T 6: 29,531,318 N61I possibly damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kcnj12 C T 11: 61,069,847 H324Y probably damaging Het
Kdm2a C T 19: 4,343,113 D405N Het
Lars2 A G 9: 123,436,301 Q474R probably benign Het
Lctl T C 9: 64,133,191 F472S possibly damaging Het
Map4k2 T C 19: 6,351,193 S590P probably benign Het
Mcf2l G T 8: 13,000,757 L337F possibly damaging Het
Mvp A G 7: 126,996,263 V225A probably damaging Het
Nfat5 T A 8: 107,339,278 D241E probably damaging Het
Olfr430 T A 1: 174,069,455 D52E probably benign Het
Pagr1a A T 7: 127,016,901 H7Q probably damaging Het
Parp8 G T 13: 116,864,245 Q787K probably damaging Het
Pcdhb2 C A 18: 37,296,316 N90K probably damaging Het
Pde6h A G 6: 136,959,334 K25R probably benign Het
Psd3 C A 8: 67,960,649 A410S probably benign Het
Pus10 A G 11: 23,667,311 N8S probably benign Het
Rnf115 T C 3: 96,788,678 L260S probably damaging Het
Sdsl A T 5: 120,463,094 Y38N probably benign Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Stxbp5l A G 16: 37,115,685 Y1177H probably damaging Het
Taar2 G A 10: 23,941,002 V147I probably benign Het
Tmed3 A T 9: 89,702,927 F92I possibly damaging Het
Tmprss15 T C 16: 79,035,198 T357A probably damaging Het
Trbv14 A T 6: 41,135,494 D75V probably damaging Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn2r115 A T 17: 23,359,508 I652F probably benign Het
Wdr17 T C 8: 54,690,022 I198V probably benign Het
Wdr27 G A 17: 14,908,571 A540V possibly damaging Het
Zfp26 A C 9: 20,438,151 Y372* probably null Het
Zfp286 A G 11: 62,779,975 V424A probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTATCAGTTTTCAATGCACACCG -3'
(R):5'- AATGATAATCCTCCACCAAAGTGTG -3'

Sequencing Primer
(F):5'- CAGCTCTGTATCAGGGAATTGTCC -3'
(R):5'- CAGAAGTTGTGATCCAGAC -3'
Posted On 2022-04-18