Mutagenetix > Incidental Mutation

Incidental Mutation 'R0744:Rims1'

70811

Institutional Source

Beutler Lab

Gene Symbol

Rims1

Ensembl Gene

ENSMUSG00000041670

Gene Name

regulating synaptic membrane exocytosis 1

Synonyms

RIM1a, RIM1, RIM1alpha, C030033M19Rik

MMRRC Submission

038925-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.620) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22286251-22805994 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 22427459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000081544

SMART Domains

Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
C2	1120	1223	7.45e-15	SMART
low complexity region	1245	1253	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000097809

SMART Domains

Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	974	1009	N/A	INTRINSIC
low complexity region	1086	1100	N/A	INTRINSIC
C2	1195	1298	7.45e-15	SMART
low complexity region	1320	1328	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000097810

SMART Domains

Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
PDB:2CJS\|C	131	193	2e-32	PDB
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	916	929	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC
C2	1256	1359	7.45e-15	SMART
low complexity region	1381	1389	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000097811

SMART Domains

Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	867	881	N/A	INTRINSIC
low complexity region	944	957	N/A	INTRINSIC
low complexity region	1063	1098	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC
C2	1284	1387	7.45e-15	SMART
low complexity region	1409	1417	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115273

SMART Domains

Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.8e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	950	985	N/A	INTRINSIC
low complexity region	1062	1076	N/A	INTRINSIC
C2	1171	1274	7.45e-15	SMART
low complexity region	1296	1304	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000185942

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fbn1	T	C	2: 125,314,814		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Rims1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Rims1	APN	1	22468242	missense	probably damaging	1.00
IGL00535:Rims1	APN	1	22432921	missense	probably benign	0.02
IGL01021:Rims1	APN	1	22486620	missense	probably damaging	1.00
IGL01106:Rims1	APN	1	22379447	missense	probably damaging	1.00
IGL01128:Rims1	APN	1	22534175	missense	probably damaging	0.97
IGL01548:Rims1	APN	1	22538602	missense	probably damaging	1.00
IGL01688:Rims1	APN	1	22397540	missense	probably benign	0.22
IGL02089:Rims1	APN	1	22630475	missense	possibly damaging	0.68
IGL02245:Rims1	APN	1	22346488	missense	probably damaging	0.98
IGL02355:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02362:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02682:Rims1	APN	1	22288484	missense	probably damaging	1.00
IGL03006:Rims1	APN	1	22296954	missense	probably damaging	0.99
IGL03054:Rims1	UTSW	1	22290109	missense	probably damaging	1.00
PIT4504001:Rims1	UTSW	1	22397460	missense
R0031:Rims1	UTSW	1	22296879	missense	probably damaging	1.00
R0118:Rims1	UTSW	1	22346407	missense	probably damaging	1.00
R0390:Rims1	UTSW	1	22596526	missense	possibly damaging	0.92
R0483:Rims1	UTSW	1	22468182	splice site	probably benign
R0836:Rims1	UTSW	1	22427459	splice site	probably null
R1218:Rims1	UTSW	1	22483175	missense	probably damaging	1.00
R1228:Rims1	UTSW	1	22472756	missense	probably null	1.00
R1374:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1474:Rims1	UTSW	1	22538281	splice site	probably benign
R1652:Rims1	UTSW	1	22292866	missense	probably damaging	1.00
R1712:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1730:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1783:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1861:Rims1	UTSW	1	22596558	missense	probably damaging	1.00
R1899:Rims1	UTSW	1	22428474	missense	probably damaging	1.00
R1937:Rims1	UTSW	1	22288530	missense	probably damaging	1.00
R2010:Rims1	UTSW	1	22296996	missense	probably damaging	1.00
R2049:Rims1	UTSW	1	22596435	missense	probably damaging	1.00
R2124:Rims1	UTSW	1	22404508	nonsense	probably null
R2860:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2861:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2914:Rims1	UTSW	1	22805630	missense	probably damaging	1.00
R3740:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3741:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3773:Rims1	UTSW	1	22421810	missense	probably damaging	1.00
R3874:Rims1	UTSW	1	22428489	missense	probably damaging	1.00
R3901:Rims1	UTSW	1	22533497	missense	probably benign	0.00
R3964:Rims1	UTSW	1	22427459	splice site	probably null
R4037:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4039:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4056:Rims1	UTSW	1	22292939	splice site	probably benign
R4062:Rims1	UTSW	1	22533583	missense	probably benign	0.00
R4552:Rims1	UTSW	1	22373494	missense	probably damaging	0.99
R4658:Rims1	UTSW	1	22427543	missense	probably damaging	0.98
R4688:Rims1	UTSW	1	22479447	nonsense	probably null
R4696:Rims1	UTSW	1	22288612	missense	probably damaging	1.00
R4720:Rims1	UTSW	1	22427481	missense	probably damaging	1.00
R4764:Rims1	UTSW	1	22479462	missense	probably damaging	1.00
R4780:Rims1	UTSW	1	22291105	missense	probably damaging	1.00
R4931:Rims1	UTSW	1	22533947	missense	probably benign	0.26
R5137:Rims1	UTSW	1	22288620	nonsense	probably null
R5153:Rims1	UTSW	1	22483247	nonsense	probably null
R5305:Rims1	UTSW	1	22596542	missense	probably damaging	0.99
R5354:Rims1	UTSW	1	22538511	missense	probably damaging	1.00
R5386:Rims1	UTSW	1	22412245	missense	probably damaging	0.99
R5485:Rims1	UTSW	1	22483208	missense	possibly damaging	0.93
R5643:Rims1	UTSW	1	22538509	missense	probably damaging	1.00
R5929:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R5988:Rims1	UTSW	1	22596463	missense	probably damaging	1.00
R6160:Rims1	UTSW	1	22432984	missense	probably damaging	0.98
R6579:Rims1	UTSW	1	22425916	missense	probably damaging	1.00
R6790:Rims1	UTSW	1	22468197	missense	probably damaging	1.00
R7048:Rims1	UTSW	1	22472820	missense	probably damaging	1.00
R7100:Rims1	UTSW	1	22346473	missense	probably benign	0.27
R7155:Rims1	UTSW	1	22432923	missense	probably damaging	0.99
R7171:Rims1	UTSW	1	22428489	missense
R7448:Rims1	UTSW	1	22404475	missense
R7505:Rims1	UTSW	1	22533996	missense	possibly damaging	0.55
R7567:Rims1	UTSW	1	22468210	missense	probably damaging	0.99
R7639:Rims1	UTSW	1	22805669	missense	probably benign	0.02
R7955:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R8005:Rims1	UTSW	1	22412213	missense
R8071:Rims1	UTSW	1	22288536	nonsense	probably null
R8465:Rims1	UTSW	1	22428480	missense	possibly damaging	0.89
R8517:Rims1	UTSW	1	22483165	missense	probably damaging	1.00
R8703:Rims1	UTSW	1	22425887	missense
R8726:Rims1	UTSW	1	22594100	missense	possibly damaging	0.88
R9090:Rims1	UTSW	1	22428522	missense
R9179:Rims1	UTSW	1	22412266	missense	probably damaging	0.99
R9271:Rims1	UTSW	1	22428522	missense
R9291:Rims1	UTSW	1	22397522	missense
R9394:Rims1	UTSW	1	22472775	missense	probably damaging	1.00
R9578:Rims1	UTSW	1	22484742	missense	probably damaging	1.00
R9614:Rims1	UTSW	1	22421745	nonsense	probably null
R9726:Rims1	UTSW	1	22630412	missense	probably null	0.21
Z1088:Rims1	UTSW	1	22288586	missense	probably damaging	1.00
Z1176:Rims1	UTSW	1	22484671	nonsense	probably null
Z1177:Rims1	UTSW	1	22296939	missense	possibly damaging	0.93
Z1177:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
Z1177:Rims1	UTSW	1	22472777	missense	probably benign	0.44
Z1177:Rims1	UTSW	1	22472804	missense	probably damaging	1.00
Z1186:Rims1	UTSW	1	22379482	missense

Predicted Primers

PCR Primer
(F):5'- TGCGGTAGAAATGTCCTTGCAGAAG -3'
(R):5'- AATCCAGGCCATGTGTTAGCCAG -3'

Sequencing Primer
(F):5'- TGTCCTTGCAGAAGAGCATTACC -3'
(R):5'- TTGTTTGGGGAAAACAACATGC -3'

Posted On

2013-09-30