Incidental Mutation 'R0744:Rims1'
ID 70811
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Name regulating synaptic membrane exocytosis 1
Synonyms RIM1alpha, C030033M19Rik, RIM1, RIM1a
MMRRC Submission 038925-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.675) question?
Stock # R0744 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 22356475-22845203 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 22497709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000081544
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097809
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097810
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097811
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115273
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185942
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,000,931 (GRCm39) L41P probably damaging Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aebp2 T G 6: 140,588,090 (GRCm39) probably null Het
AI987944 T C 7: 41,026,283 (GRCm39) Y6C probably damaging Het
Ascc3 T C 10: 50,721,762 (GRCm39) W2072R probably benign Het
Asxl3 A G 18: 22,649,097 (GRCm39) D362G probably damaging Het
Baiap2l1 T A 5: 144,203,451 (GRCm39) D479V probably benign Het
Bdp1 A T 13: 100,172,333 (GRCm39) H2094Q probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Cd226 A C 18: 89,225,144 (GRCm39) probably benign Het
Clip1 T C 5: 123,768,784 (GRCm39) D605G probably benign Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dzip3 A G 16: 48,780,038 (GRCm39) Y301H probably damaging Het
Ephb4 T A 5: 137,363,929 (GRCm39) N600K probably damaging Het
Erich6 T A 3: 58,543,543 (GRCm39) probably benign Het
Fbn1 T C 2: 125,156,734 (GRCm39) probably benign Het
Fryl A T 5: 73,246,424 (GRCm39) probably benign Het
Galnt17 T A 5: 131,179,754 (GRCm39) D131V probably damaging Het
Gm6619 T A 6: 131,467,297 (GRCm39) L54Q probably damaging Het
Herc2 T C 7: 55,855,784 (GRCm39) probably benign Het
Hic1 T A 11: 75,056,627 (GRCm39) Q754L possibly damaging Het
Hnf4g A T 3: 3,716,689 (GRCm39) D286V possibly damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itih1 A T 14: 30,663,512 (GRCm39) V164E probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Lrfn5 A C 12: 61,886,454 (GRCm39) T81P probably damaging Het
Lrrc58 A G 16: 37,698,935 (GRCm39) probably benign Het
Marchf6 T C 15: 31,480,437 (GRCm39) Y562C probably benign Het
Mark1 T A 1: 184,653,805 (GRCm39) I166F probably damaging Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mast4 C G 13: 102,873,895 (GRCm39) Q1632H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mgst3 A G 1: 167,201,374 (GRCm39) Y104H probably damaging Het
Mlxipl C T 5: 135,161,329 (GRCm39) T416I possibly damaging Het
Mthfd2l T C 5: 91,094,801 (GRCm39) V90A probably damaging Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Muc1 C A 3: 89,137,635 (GRCm39) P159Q possibly damaging Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,439,298 (GRCm39) probably benign Het
Or10g3b T C 14: 52,586,835 (GRCm39) I223V probably benign Het
Or2t29 T A 11: 58,433,988 (GRCm39) M105L possibly damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Pdcd6 A G 13: 74,464,443 (GRCm39) probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Pramel23 A T 4: 143,425,056 (GRCm39) M129K probably benign Het
Pzp A G 6: 128,493,158 (GRCm39) probably benign Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapgef3 G A 15: 97,659,466 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rgs11 T A 17: 26,422,292 (GRCm39) M29K probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Samd9l T C 6: 3,372,725 (GRCm39) E1512G possibly damaging Het
Sgsm1 C T 5: 113,427,050 (GRCm39) A127T probably benign Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc26a1 T A 5: 108,821,389 (GRCm39) T167S probably benign Het
Slc2a12 T C 10: 22,577,915 (GRCm39) probably benign Het
Slc44a5 T C 3: 153,971,111 (GRCm39) S654P probably damaging Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Slc6a13 T G 6: 121,279,826 (GRCm39) W67G probably damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,059,313 (GRCm39) probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Supt20 T A 3: 54,622,122 (GRCm39) Y409N probably damaging Het
Synrg C T 11: 83,915,131 (GRCm39) Q1046* probably null Het
Tab2 T C 10: 7,783,345 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm6 T C 2: 129,993,681 (GRCm39) V640A probably benign Het
Tle2 T C 10: 81,424,781 (GRCm39) F667L probably damaging Het
Tnfaip3 C A 10: 18,878,697 (GRCm39) A704S probably benign Het
Tomm34 T C 2: 163,912,896 (GRCm39) N22D probably benign Het
Trabd2b A G 4: 114,437,519 (GRCm39) Q232R probably benign Het
Trim62 A G 4: 128,778,008 (GRCm39) S16G probably damaging Het
Ttc28 T A 5: 111,378,947 (GRCm39) I1144N probably damaging Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Ush2a C T 1: 188,546,603 (GRCm39) probably benign Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zbed5 T A 5: 129,931,113 (GRCm39) V354E possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22,507,323 (GRCm39) missense probably damaging 1.00
IGL00535:Rims1 APN 1 22,503,172 (GRCm39) missense probably benign 0.02
IGL01021:Rims1 APN 1 22,525,701 (GRCm39) missense probably damaging 1.00
IGL01106:Rims1 APN 1 22,449,671 (GRCm39) missense probably damaging 1.00
IGL01128:Rims1 APN 1 22,573,256 (GRCm39) missense probably damaging 0.97
IGL01548:Rims1 APN 1 22,577,683 (GRCm39) missense probably damaging 1.00
IGL01688:Rims1 APN 1 22,467,764 (GRCm39) missense probably benign 0.22
IGL02089:Rims1 APN 1 22,669,556 (GRCm39) missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22,416,712 (GRCm39) missense probably damaging 0.98
IGL02355:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02362:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02682:Rims1 APN 1 22,358,708 (GRCm39) missense probably damaging 1.00
IGL03006:Rims1 APN 1 22,367,178 (GRCm39) missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22,360,333 (GRCm39) missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22,467,684 (GRCm39) missense
R0031:Rims1 UTSW 1 22,367,103 (GRCm39) missense probably damaging 1.00
R0118:Rims1 UTSW 1 22,416,631 (GRCm39) missense probably damaging 1.00
R0390:Rims1 UTSW 1 22,635,607 (GRCm39) missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22,507,263 (GRCm39) splice site probably benign
R0836:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R1218:Rims1 UTSW 1 22,522,256 (GRCm39) missense probably damaging 1.00
R1228:Rims1 UTSW 1 22,511,837 (GRCm39) missense probably null 1.00
R1374:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1474:Rims1 UTSW 1 22,577,362 (GRCm39) splice site probably benign
R1652:Rims1 UTSW 1 22,363,090 (GRCm39) missense probably damaging 1.00
R1712:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1730:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22,635,639 (GRCm39) missense probably damaging 1.00
R1899:Rims1 UTSW 1 22,498,725 (GRCm39) missense probably damaging 1.00
R1937:Rims1 UTSW 1 22,358,754 (GRCm39) missense probably damaging 1.00
R2010:Rims1 UTSW 1 22,367,220 (GRCm39) missense probably damaging 1.00
R2049:Rims1 UTSW 1 22,635,516 (GRCm39) missense probably damaging 1.00
R2124:Rims1 UTSW 1 22,474,732 (GRCm39) nonsense probably null
R2860:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2861:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2914:Rims1 UTSW 1 22,844,711 (GRCm39) missense probably damaging 1.00
R3740:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3741:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3773:Rims1 UTSW 1 22,492,034 (GRCm39) missense probably damaging 1.00
R3874:Rims1 UTSW 1 22,498,740 (GRCm39) missense probably damaging 1.00
R3901:Rims1 UTSW 1 22,572,578 (GRCm39) missense probably benign 0.00
R3964:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R4037:Rims1 UTSW 1 22,514,793 (GRCm39) missense probably damaging 0.96
R4039:Rims1 UTSW 1 22,514,793 (GRCm39) missense probably damaging 0.96
R4056:Rims1 UTSW 1 22,363,163 (GRCm39) splice site probably benign
R4062:Rims1 UTSW 1 22,572,664 (GRCm39) missense probably benign 0.00
R4552:Rims1 UTSW 1 22,443,718 (GRCm39) missense probably damaging 0.99
R4658:Rims1 UTSW 1 22,497,793 (GRCm39) missense probably damaging 0.98
R4688:Rims1 UTSW 1 22,518,528 (GRCm39) nonsense probably null
R4696:Rims1 UTSW 1 22,358,836 (GRCm39) missense probably damaging 1.00
R4720:Rims1 UTSW 1 22,497,731 (GRCm39) missense probably damaging 1.00
R4764:Rims1 UTSW 1 22,518,543 (GRCm39) missense probably damaging 1.00
R4780:Rims1 UTSW 1 22,361,329 (GRCm39) missense probably damaging 1.00
R4931:Rims1 UTSW 1 22,573,028 (GRCm39) missense probably benign 0.26
R5137:Rims1 UTSW 1 22,358,844 (GRCm39) nonsense probably null
R5153:Rims1 UTSW 1 22,522,328 (GRCm39) nonsense probably null
R5305:Rims1 UTSW 1 22,635,623 (GRCm39) missense probably damaging 0.99
R5354:Rims1 UTSW 1 22,577,592 (GRCm39) missense probably damaging 1.00
R5386:Rims1 UTSW 1 22,482,469 (GRCm39) missense probably damaging 0.99
R5485:Rims1 UTSW 1 22,522,289 (GRCm39) missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22,577,590 (GRCm39) missense probably damaging 1.00
R5929:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R5988:Rims1 UTSW 1 22,635,544 (GRCm39) missense probably damaging 1.00
R6160:Rims1 UTSW 1 22,503,235 (GRCm39) missense probably damaging 0.98
R6579:Rims1 UTSW 1 22,496,166 (GRCm39) missense probably damaging 1.00
R6790:Rims1 UTSW 1 22,507,278 (GRCm39) missense probably damaging 1.00
R7048:Rims1 UTSW 1 22,511,901 (GRCm39) missense probably damaging 1.00
R7100:Rims1 UTSW 1 22,416,697 (GRCm39) missense probably benign 0.27
R7155:Rims1 UTSW 1 22,503,174 (GRCm39) missense probably damaging 0.99
R7171:Rims1 UTSW 1 22,498,740 (GRCm39) missense
R7448:Rims1 UTSW 1 22,474,699 (GRCm39) missense
R7505:Rims1 UTSW 1 22,573,077 (GRCm39) missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22,507,291 (GRCm39) missense probably damaging 0.99
R7639:Rims1 UTSW 1 22,844,750 (GRCm39) missense probably benign 0.02
R7955:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R8005:Rims1 UTSW 1 22,482,437 (GRCm39) missense
R8071:Rims1 UTSW 1 22,358,760 (GRCm39) nonsense probably null
R8465:Rims1 UTSW 1 22,498,731 (GRCm39) missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22,522,246 (GRCm39) missense probably damaging 1.00
R8703:Rims1 UTSW 1 22,496,137 (GRCm39) missense
R8726:Rims1 UTSW 1 22,633,181 (GRCm39) missense possibly damaging 0.88
R9090:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9179:Rims1 UTSW 1 22,482,490 (GRCm39) missense probably damaging 0.99
R9271:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9291:Rims1 UTSW 1 22,467,746 (GRCm39) missense
R9394:Rims1 UTSW 1 22,511,856 (GRCm39) missense probably damaging 1.00
R9578:Rims1 UTSW 1 22,523,823 (GRCm39) missense probably damaging 1.00
R9614:Rims1 UTSW 1 22,491,969 (GRCm39) nonsense probably null
R9726:Rims1 UTSW 1 22,669,493 (GRCm39) missense probably null 0.21
Z1088:Rims1 UTSW 1 22,358,810 (GRCm39) missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22,523,752 (GRCm39) nonsense probably null
Z1177:Rims1 UTSW 1 22,511,858 (GRCm39) missense probably benign 0.44
Z1177:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22,367,163 (GRCm39) missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22,511,885 (GRCm39) missense probably damaging 1.00
Z1186:Rims1 UTSW 1 22,449,706 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGCGGTAGAAATGTCCTTGCAGAAG -3'
(R):5'- AATCCAGGCCATGTGTTAGCCAG -3'

Sequencing Primer
(F):5'- TGTCCTTGCAGAAGAGCATTACC -3'
(R):5'- TTGTTTGGGGAAAACAACATGC -3'
Posted On 2013-09-30