Incidental Mutation 'R9352:Vps16'
ID 708110
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R9352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 130441903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,682 F1500S probably damaging Het
Adamtsl3 A T 7: 82,442,448 Q123L probably damaging Het
Adarb2 T A 13: 8,757,392 L743Q probably damaging Het
Alpk2 C A 18: 65,306,712 D537Y probably benign Het
Anxa4 C T 6: 86,765,793 probably benign Het
Arfgap3 T A 15: 83,306,926 I464L possibly damaging Het
Asb2 C T 12: 103,330,439 V320I probably damaging Het
Axl T C 7: 25,763,327 T659A possibly damaging Het
Bbof1 A G 12: 84,414,620 H139R probably benign Het
Birc6 G A 17: 74,658,352 probably null Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Chil3 A T 3: 106,160,471 F126Y probably damaging Het
Chrnb4 T A 9: 55,043,883 D32V probably benign Het
Chst15 C A 7: 132,270,528 C8F probably damaging Het
Cntnap5c A G 17: 58,092,468 I439V probably benign Het
Crisp2 T A 17: 40,767,309 N194I probably damaging Het
Csrnp1 G A 9: 119,972,931 T354M probably benign Het
Cul1 T A 6: 47,502,492 S231T probably benign Het
Cyp27a1 C T 1: 74,713,761 T44M possibly damaging Het
Dgkg T C 16: 22,579,831 D232G probably damaging Het
Dnah1 G T 14: 31,316,663 Q154K probably benign Het
Dnmt1 A G 9: 20,929,088 V304A probably benign Het
Dok6 T C 18: 89,474,009 N148S probably benign Het
Fam71e2 T A 7: 4,758,606 Y369F Het
Fnta A T 8: 26,011,091 W134R probably damaging Het
Gm32742 T G 9: 51,141,244 Q1441P possibly damaging Het
Gm3486 T C 14: 41,486,361 Q131R possibly damaging Het
Gnptab A G 10: 88,432,488 N486D probably benign Het
H2-Q4 T G 17: 35,382,933 F257C probably damaging Het
Hfe A G 13: 23,706,136 V218A probably benign Het
Htr2b A G 1: 86,099,572 V404A probably benign Het
Hyou1 T A 9: 44,389,629 probably null Het
Ikbkb T C 8: 22,660,428 D746G probably benign Het
Ikzf4 T C 10: 128,636,754 N251S probably benign Het
Il23r A C 6: 67,426,608 N436K probably damaging Het
Impg2 A T 16: 56,252,107 I301L probably benign Het
Irf4 A T 13: 30,752,723 M146L probably benign Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kctd3 T C 1: 188,972,580 S665G probably damaging Het
Kiz T C 2: 146,953,007 S596P probably damaging Het
Kpna2 T C 11: 106,989,466 E452G probably damaging Het
Lclat1 A G 17: 73,161,942 Y39C probably damaging Het
Lig3 A G 11: 82,796,145 S705G probably benign Het
Lrp1b T C 2: 40,858,426 D3134G Het
Map3k8 C T 18: 4,349,170 M49I probably benign Het
Mep1b A G 18: 21,076,374 D54G probably damaging Het
Mgat5b T A 11: 116,966,707 S342R probably benign Het
Mthfd2l G T 5: 90,961,313 V201L possibly damaging Het
Naip6 G T 13: 100,301,385 T371K possibly damaging Het
Naxd T C 8: 11,505,504 I104T probably damaging Het
Nbeal2 T A 9: 110,627,848 I2361F probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr145 A G 9: 37,897,416 E4G probably benign Het
Olfr23 A G 11: 73,940,644 T133A probably benign Het
Olfr790 A T 10: 129,501,495 M196L probably benign Het
Olfr894 T G 9: 38,219,387 L185R probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Polq T C 16: 37,041,890 F591L probably damaging Het
Ppp2r1a A T 17: 20,965,237 probably null Het
Prrc1 A G 18: 57,389,245 Y383C probably damaging Het
Ptgfr A T 3: 151,835,523 V116D probably damaging Het
Qpctl C T 7: 19,144,674 R292Q possibly damaging Het
Rasip1 G A 7: 45,628,856 V194M possibly damaging Het
Rbbp4 A T 4: 129,317,705 N385K probably benign Het
Rbbp8nl A G 2: 180,279,260 S444P probably benign Het
Sf3a1 G A 11: 4,160,494 A3T unknown Het
Slc1a4 A G 11: 20,332,025 S150P probably damaging Het
Slc28a2 T C 2: 122,451,041 probably null Het
Slc30a5 A G 13: 100,803,872 I702T probably benign Het
Slc36a4 T A 9: 15,722,023 probably null Het
Slf2 A G 19: 44,943,518 R671G probably null Het
Smarcc1 A G 9: 110,206,152 K881R probably null Het
Srsf11 A G 3: 158,012,199 V414A unknown Het
Tcn2 T C 11: 3,923,446 N300S probably damaging Het
Tecta T C 9: 42,337,851 K1905R probably damaging Het
Tex30 T G 1: 44,091,593 probably null Het
Tktl2 A T 8: 66,513,322 I511F possibly damaging Het
Tpp1 G T 7: 105,749,674 Q183K probably benign Het
Trib2 A C 12: 15,815,412 I30R probably benign Het
Tti1 A G 2: 158,000,772 L779P probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b GAGCCA GAGCCATAGCCA 4: 43,177,313 probably null Het
Vmn2r112 A G 17: 22,603,498 T386A probably damaging Het
Zan T G 5: 137,436,483 N2186T unknown Het
Zdhhc11 C T 13: 73,973,681 R104* probably null Het
Zfp318 T G 17: 46,410,358 H1176Q probably damaging Het
Zfp335 G A 2: 164,900,322 H581Y probably damaging Het
Zfp7 T C 15: 76,891,474 I572T probably damaging Het
Zfp955a T C 17: 33,242,361 T266A probably benign Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCCTGAGTTTGTATCG -3'
(R):5'- GCACTCTTCCACTGTCCTAGAG -3'

Sequencing Primer
(F):5'- CCCTGAGTTTGTATCGACAGG -3'
(R):5'- CCACTGTCCTAGAGATGCTG -3'
Posted On 2022-04-18