Incidental Mutation 'R9352:Chst15'
ID 708134
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 132270528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 8 (C8F)
Ref Sequence ENSEMBL: ENSMUSP00000076682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000077472
AA Change: C8F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: C8F

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080215
AA Change: C8F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: C8F

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,682 F1500S probably damaging Het
Adamtsl3 A T 7: 82,442,448 Q123L probably damaging Het
Adarb2 T A 13: 8,757,392 L743Q probably damaging Het
Alpk2 C A 18: 65,306,712 D537Y probably benign Het
Anxa4 C T 6: 86,765,793 probably benign Het
Arfgap3 T A 15: 83,306,926 I464L possibly damaging Het
Asb2 C T 12: 103,330,439 V320I probably damaging Het
Axl T C 7: 25,763,327 T659A possibly damaging Het
Bbof1 A G 12: 84,414,620 H139R probably benign Het
Birc6 G A 17: 74,658,352 probably null Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Chil3 A T 3: 106,160,471 F126Y probably damaging Het
Chrnb4 T A 9: 55,043,883 D32V probably benign Het
Cntnap5c A G 17: 58,092,468 I439V probably benign Het
Crisp2 T A 17: 40,767,309 N194I probably damaging Het
Csrnp1 G A 9: 119,972,931 T354M probably benign Het
Cul1 T A 6: 47,502,492 S231T probably benign Het
Cyp27a1 C T 1: 74,713,761 T44M possibly damaging Het
Dgkg T C 16: 22,579,831 D232G probably damaging Het
Dnah1 G T 14: 31,316,663 Q154K probably benign Het
Dnmt1 A G 9: 20,929,088 V304A probably benign Het
Dok6 T C 18: 89,474,009 N148S probably benign Het
Fam71e2 T A 7: 4,758,606 Y369F Het
Fnta A T 8: 26,011,091 W134R probably damaging Het
Gm32742 T G 9: 51,141,244 Q1441P possibly damaging Het
Gm3486 T C 14: 41,486,361 Q131R possibly damaging Het
Gnptab A G 10: 88,432,488 N486D probably benign Het
H2-Q4 T G 17: 35,382,933 F257C probably damaging Het
Hfe A G 13: 23,706,136 V218A probably benign Het
Htr2b A G 1: 86,099,572 V404A probably benign Het
Hyou1 T A 9: 44,389,629 probably null Het
Ikbkb T C 8: 22,660,428 D746G probably benign Het
Ikzf4 T C 10: 128,636,754 N251S probably benign Het
Il23r A C 6: 67,426,608 N436K probably damaging Het
Impg2 A T 16: 56,252,107 I301L probably benign Het
Irf4 A T 13: 30,752,723 M146L probably benign Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kctd3 T C 1: 188,972,580 S665G probably damaging Het
Kiz T C 2: 146,953,007 S596P probably damaging Het
Kpna2 T C 11: 106,989,466 E452G probably damaging Het
Lclat1 A G 17: 73,161,942 Y39C probably damaging Het
Lig3 A G 11: 82,796,145 S705G probably benign Het
Lrp1b T C 2: 40,858,426 D3134G Het
Map3k8 C T 18: 4,349,170 M49I probably benign Het
Mep1b A G 18: 21,076,374 D54G probably damaging Het
Mgat5b T A 11: 116,966,707 S342R probably benign Het
Mthfd2l G T 5: 90,961,313 V201L possibly damaging Het
Naip6 G T 13: 100,301,385 T371K possibly damaging Het
Naxd T C 8: 11,505,504 I104T probably damaging Het
Nbeal2 T A 9: 110,627,848 I2361F probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr145 A G 9: 37,897,416 E4G probably benign Het
Olfr23 A G 11: 73,940,644 T133A probably benign Het
Olfr790 A T 10: 129,501,495 M196L probably benign Het
Olfr894 T G 9: 38,219,387 L185R probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Polq T C 16: 37,041,890 F591L probably damaging Het
Ppp2r1a A T 17: 20,965,237 probably null Het
Prrc1 A G 18: 57,389,245 Y383C probably damaging Het
Ptgfr A T 3: 151,835,523 V116D probably damaging Het
Qpctl C T 7: 19,144,674 R292Q possibly damaging Het
Rasip1 G A 7: 45,628,856 V194M possibly damaging Het
Rbbp4 A T 4: 129,317,705 N385K probably benign Het
Rbbp8nl A G 2: 180,279,260 S444P probably benign Het
Sf3a1 G A 11: 4,160,494 A3T unknown Het
Slc1a4 A G 11: 20,332,025 S150P probably damaging Het
Slc28a2 T C 2: 122,451,041 probably null Het
Slc30a5 A G 13: 100,803,872 I702T probably benign Het
Slc36a4 T A 9: 15,722,023 probably null Het
Slf2 A G 19: 44,943,518 R671G probably null Het
Smarcc1 A G 9: 110,206,152 K881R probably null Het
Srsf11 A G 3: 158,012,199 V414A unknown Het
Tcn2 T C 11: 3,923,446 N300S probably damaging Het
Tecta T C 9: 42,337,851 K1905R probably damaging Het
Tex30 T G 1: 44,091,593 probably null Het
Tktl2 A T 8: 66,513,322 I511F possibly damaging Het
Tpp1 G T 7: 105,749,674 Q183K probably benign Het
Trib2 A C 12: 15,815,412 I30R probably benign Het
Tti1 A G 2: 158,000,772 L779P probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b GAGCCA GAGCCATAGCCA 4: 43,177,313 probably null Het
Vmn2r112 A G 17: 22,603,498 T386A probably damaging Het
Vps16 T C 2: 130,441,903 probably null Het
Zan T G 5: 137,436,483 N2186T unknown Het
Zdhhc11 C T 13: 73,973,681 R104* probably null Het
Zfp318 T G 17: 46,410,358 H1176Q probably damaging Het
Zfp335 G A 2: 164,900,322 H581Y probably damaging Het
Zfp7 T C 15: 76,891,474 I572T probably damaging Het
Zfp955a T C 17: 33,242,361 T266A probably benign Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R7911:Chst15 UTSW 7 132270522 missense probably benign 0.12
R8282:Chst15 UTSW 7 132270150 missense probably benign
R8342:Chst15 UTSW 7 132247886 missense probably benign 0.15
R9011:Chst15 UTSW 7 132270517 missense probably benign
R9093:Chst15 UTSW 7 132268917 critical splice donor site probably null
R9329:Chst15 UTSW 7 132266791 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGACCAGGCTACATCGCTTC -3'
(R):5'- TGAACCAAAGACTGTGCCTC -3'

Sequencing Primer
(F):5'- AAACCCACCCCAGTTTTCATTG -3'
(R):5'- AAAGACTGTGCCTCATTCTCTAGTG -3'
Posted On 2022-04-18