Incidental Mutation 'R9352:Chrnb4'
ID 708146
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Name cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms Acrb-4, Acrb4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 55028154-55048779 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55043883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 32 (D32V)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
AlphaFold Q8R493
Predicted Effect probably benign
Transcript: ENSMUST00000034854
AA Change: D32V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: D32V

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,682 F1500S probably damaging Het
Adamtsl3 A T 7: 82,442,448 Q123L probably damaging Het
Adarb2 T A 13: 8,757,392 L743Q probably damaging Het
Alpk2 C A 18: 65,306,712 D537Y probably benign Het
Anxa4 C T 6: 86,765,793 probably benign Het
Arfgap3 T A 15: 83,306,926 I464L possibly damaging Het
Asb2 C T 12: 103,330,439 V320I probably damaging Het
Axl T C 7: 25,763,327 T659A possibly damaging Het
Bbof1 A G 12: 84,414,620 H139R probably benign Het
Birc6 G A 17: 74,658,352 probably null Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Chil3 A T 3: 106,160,471 F126Y probably damaging Het
Chst15 C A 7: 132,270,528 C8F probably damaging Het
Cntnap5c A G 17: 58,092,468 I439V probably benign Het
Crisp2 T A 17: 40,767,309 N194I probably damaging Het
Csrnp1 G A 9: 119,972,931 T354M probably benign Het
Cul1 T A 6: 47,502,492 S231T probably benign Het
Cyp27a1 C T 1: 74,713,761 T44M possibly damaging Het
Dgkg T C 16: 22,579,831 D232G probably damaging Het
Dnah1 G T 14: 31,316,663 Q154K probably benign Het
Dnmt1 A G 9: 20,929,088 V304A probably benign Het
Dok6 T C 18: 89,474,009 N148S probably benign Het
Fam71e2 T A 7: 4,758,606 Y369F Het
Fnta A T 8: 26,011,091 W134R probably damaging Het
Gm32742 T G 9: 51,141,244 Q1441P possibly damaging Het
Gm3486 T C 14: 41,486,361 Q131R possibly damaging Het
Gnptab A G 10: 88,432,488 N486D probably benign Het
H2-Q4 T G 17: 35,382,933 F257C probably damaging Het
Hfe A G 13: 23,706,136 V218A probably benign Het
Htr2b A G 1: 86,099,572 V404A probably benign Het
Hyou1 T A 9: 44,389,629 probably null Het
Ikbkb T C 8: 22,660,428 D746G probably benign Het
Ikzf4 T C 10: 128,636,754 N251S probably benign Het
Il23r A C 6: 67,426,608 N436K probably damaging Het
Impg2 A T 16: 56,252,107 I301L probably benign Het
Irf4 A T 13: 30,752,723 M146L probably benign Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kctd3 T C 1: 188,972,580 S665G probably damaging Het
Kiz T C 2: 146,953,007 S596P probably damaging Het
Kpna2 T C 11: 106,989,466 E452G probably damaging Het
Lclat1 A G 17: 73,161,942 Y39C probably damaging Het
Lig3 A G 11: 82,796,145 S705G probably benign Het
Lrp1b T C 2: 40,858,426 D3134G Het
Map3k8 C T 18: 4,349,170 M49I probably benign Het
Mep1b A G 18: 21,076,374 D54G probably damaging Het
Mgat5b T A 11: 116,966,707 S342R probably benign Het
Mthfd2l G T 5: 90,961,313 V201L possibly damaging Het
Naip6 G T 13: 100,301,385 T371K possibly damaging Het
Naxd T C 8: 11,505,504 I104T probably damaging Het
Nbeal2 T A 9: 110,627,848 I2361F probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr145 A G 9: 37,897,416 E4G probably benign Het
Olfr23 A G 11: 73,940,644 T133A probably benign Het
Olfr790 A T 10: 129,501,495 M196L probably benign Het
Olfr894 T G 9: 38,219,387 L185R probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Polq T C 16: 37,041,890 F591L probably damaging Het
Ppp2r1a A T 17: 20,965,237 probably null Het
Prrc1 A G 18: 57,389,245 Y383C probably damaging Het
Ptgfr A T 3: 151,835,523 V116D probably damaging Het
Qpctl C T 7: 19,144,674 R292Q possibly damaging Het
Rasip1 G A 7: 45,628,856 V194M possibly damaging Het
Rbbp4 A T 4: 129,317,705 N385K probably benign Het
Rbbp8nl A G 2: 180,279,260 S444P probably benign Het
Sf3a1 G A 11: 4,160,494 A3T unknown Het
Slc1a4 A G 11: 20,332,025 S150P probably damaging Het
Slc28a2 T C 2: 122,451,041 probably null Het
Slc30a5 A G 13: 100,803,872 I702T probably benign Het
Slc36a4 T A 9: 15,722,023 probably null Het
Slf2 A G 19: 44,943,518 R671G probably null Het
Smarcc1 A G 9: 110,206,152 K881R probably null Het
Srsf11 A G 3: 158,012,199 V414A unknown Het
Tcn2 T C 11: 3,923,446 N300S probably damaging Het
Tecta T C 9: 42,337,851 K1905R probably damaging Het
Tex30 T G 1: 44,091,593 probably null Het
Tktl2 A T 8: 66,513,322 I511F possibly damaging Het
Tpp1 G T 7: 105,749,674 Q183K probably benign Het
Trib2 A C 12: 15,815,412 I30R probably benign Het
Tti1 A G 2: 158,000,772 L779P probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b GAGCCA GAGCCATAGCCA 4: 43,177,313 probably null Het
Vmn2r112 A G 17: 22,603,498 T386A probably damaging Het
Vps16 T C 2: 130,441,903 probably null Het
Zan T G 5: 137,436,483 N2186T unknown Het
Zdhhc11 C T 13: 73,973,681 R104* probably null Het
Zfp318 T G 17: 46,410,358 H1176Q probably damaging Het
Zfp335 G A 2: 164,900,322 H581Y probably damaging Het
Zfp7 T C 15: 76,891,474 I572T probably damaging Het
Zfp955a T C 17: 33,242,361 T266A probably benign Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0345:Chrnb4 UTSW 9 55035594 missense probably benign
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2204:Chrnb4 UTSW 9 55043848 missense probably damaging 1.00
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R3876:Chrnb4 UTSW 9 55043898 missense probably damaging 1.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
R8399:Chrnb4 UTSW 9 55043823 missense probably benign 0.02
R9140:Chrnb4 UTSW 9 55034671 missense
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCTCCCCAAAGAGTCCTG -3'
(R):5'- ATGACACAGACAAGCCTGTTGG -3'

Sequencing Primer
(F):5'- AAGAGTCCTGCCTCTTCTCCTAAG -3'
(R):5'- TAGCTCCACCCACTGCAAGTC -3'
Posted On 2022-04-18