Incidental Mutation 'R9352:Birc6'
ID 708185
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Name baculoviral IAP repeat-containing 6
Synonyms D630005A10Rik, A430032G04Rik, apollon, Bruce, A430040A19Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9352 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74835290-75010351 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 74965347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182817] [ENSMUST00000182944] [ENSMUST00000183224]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000180037
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182133
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182597
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182817
SMART Domains Protein: ENSMUSP00000138349
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 63 82 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182944
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183224
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183249
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A T 7: 82,091,656 (GRCm39) Q123L probably damaging Het
Adarb2 T A 13: 8,807,428 (GRCm39) L743Q probably damaging Het
Alpk2 C A 18: 65,439,783 (GRCm39) D537Y probably benign Het
Anxa4 C T 6: 86,742,775 (GRCm39) probably benign Het
Arfgap3 T A 15: 83,191,127 (GRCm39) I464L possibly damaging Het
Asb2 C T 12: 103,296,698 (GRCm39) V320I probably damaging Het
Axl T C 7: 25,462,752 (GRCm39) T659A possibly damaging Het
Bbof1 A G 12: 84,461,394 (GRCm39) H139R probably benign Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Chil3 A T 3: 106,067,787 (GRCm39) F126Y probably damaging Het
Chrnb4 T A 9: 54,951,167 (GRCm39) D32V probably benign Het
Chst15 C A 7: 131,872,257 (GRCm39) C8F probably damaging Het
Cntnap5c A G 17: 58,399,463 (GRCm39) I439V probably benign Het
Crisp2 T A 17: 41,078,200 (GRCm39) N194I probably damaging Het
Csrnp1 G A 9: 119,801,997 (GRCm39) T354M probably benign Het
Cul1 T A 6: 47,479,426 (GRCm39) S231T probably benign Het
Cyp27a1 C T 1: 74,752,920 (GRCm39) T44M possibly damaging Het
Dgkg T C 16: 22,398,581 (GRCm39) D232G probably damaging Het
Dnah1 G T 14: 31,038,620 (GRCm39) Q154K probably benign Het
Dnmt1 A G 9: 20,840,384 (GRCm39) V304A probably benign Het
Dok6 T C 18: 89,492,133 (GRCm39) N148S probably benign Het
Fnta A T 8: 26,501,119 (GRCm39) W134R probably damaging Het
Garin5b T A 7: 4,761,605 (GRCm39) Y369F Het
Gm32742 T G 9: 51,052,544 (GRCm39) Q1441P possibly damaging Het
Gm3486 T C 14: 41,208,318 (GRCm39) Q131R possibly damaging Het
Gnptab A G 10: 88,268,350 (GRCm39) N486D probably benign Het
H2-Q4 T G 17: 35,601,909 (GRCm39) F257C probably damaging Het
Hfe A G 13: 23,890,119 (GRCm39) V218A probably benign Het
Htr2b A G 1: 86,027,294 (GRCm39) V404A probably benign Het
Hyou1 T A 9: 44,300,926 (GRCm39) probably null Het
Ikbkb T C 8: 23,150,444 (GRCm39) D746G probably benign Het
Ikzf4 T C 10: 128,472,623 (GRCm39) N251S probably benign Het
Il23r A C 6: 67,403,592 (GRCm39) N436K probably damaging Het
Impg2 A T 16: 56,072,470 (GRCm39) I301L probably benign Het
Irf4 A T 13: 30,936,706 (GRCm39) M146L probably benign Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Kctd3 T C 1: 188,704,777 (GRCm39) S665G probably damaging Het
Kiz T C 2: 146,794,927 (GRCm39) S596P probably damaging Het
Kpna2 T C 11: 106,880,292 (GRCm39) E452G probably damaging Het
Lclat1 A G 17: 73,468,937 (GRCm39) Y39C probably damaging Het
Lig3 A G 11: 82,686,971 (GRCm39) S705G probably benign Het
Lrp1b T C 2: 40,748,438 (GRCm39) D3134G Het
Map3k8 C T 18: 4,349,170 (GRCm39) M49I probably benign Het
Mep1b A G 18: 21,209,431 (GRCm39) D54G probably damaging Het
Mgat5b T A 11: 116,857,533 (GRCm39) S342R probably benign Het
Mthfd2l G T 5: 91,109,172 (GRCm39) V201L possibly damaging Het
Naip6 G T 13: 100,437,893 (GRCm39) T371K possibly damaging Het
Naxd T C 8: 11,555,504 (GRCm39) I104T probably damaging Het
Nbeal2 T A 9: 110,456,916 (GRCm39) I2361F probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or1e17 A G 11: 73,831,470 (GRCm39) T133A probably benign Het
Or6c75 A T 10: 129,337,364 (GRCm39) M196L probably benign Het
Or8b8 A G 9: 37,808,712 (GRCm39) E4G probably benign Het
Or8c16 T G 9: 38,130,683 (GRCm39) L185R probably damaging Het
Pga5 C T 19: 10,646,897 (GRCm39) G303S probably damaging Het
Polq T C 16: 36,862,252 (GRCm39) F591L probably damaging Het
Ppp2r1a A T 17: 21,185,499 (GRCm39) probably null Het
Prrc1 A G 18: 57,522,317 (GRCm39) Y383C probably damaging Het
Ptgfr A T 3: 151,541,160 (GRCm39) V116D probably damaging Het
Qpctl C T 7: 18,878,599 (GRCm39) R292Q possibly damaging Het
Rasip1 G A 7: 45,278,280 (GRCm39) V194M possibly damaging Het
Rbbp4 A T 4: 129,211,498 (GRCm39) N385K probably benign Het
Rbbp8nl A G 2: 179,921,053 (GRCm39) S444P probably benign Het
Resf1 T C 6: 149,236,180 (GRCm39) F1500S probably damaging Het
Sf3a1 G A 11: 4,110,494 (GRCm39) A3T unknown Het
Slc1a4 A G 11: 20,282,025 (GRCm39) S150P probably damaging Het
Slc28a2 T C 2: 122,281,522 (GRCm39) probably null Het
Slc30a5 A G 13: 100,940,380 (GRCm39) I702T probably benign Het
Slc36a4 T A 9: 15,633,319 (GRCm39) probably null Het
Slf2 A G 19: 44,931,957 (GRCm39) R671G probably null Het
Smarcc1 A G 9: 110,035,220 (GRCm39) K881R probably null Het
Srsf11 A G 3: 157,717,836 (GRCm39) V414A unknown Het
Tcn2 T C 11: 3,873,446 (GRCm39) N300S probably damaging Het
Tecta T C 9: 42,249,147 (GRCm39) K1905R probably damaging Het
Tex30 T G 1: 44,130,753 (GRCm39) probably null Het
Tktl2 A T 8: 66,965,974 (GRCm39) I511F possibly damaging Het
Tpp1 G T 7: 105,398,881 (GRCm39) Q183K probably benign Het
Trib2 A C 12: 15,865,413 (GRCm39) I30R probably benign Het
Tti1 A G 2: 157,842,692 (GRCm39) L779P probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b GAGCCA GAGCCATAGCCA 4: 43,177,313 (GRCm39) probably null Het
Vmn2r112 A G 17: 22,822,479 (GRCm39) T386A probably damaging Het
Vps16 T C 2: 130,283,823 (GRCm39) probably null Het
Zan T G 5: 137,434,745 (GRCm39) N2186T unknown Het
Zdhhc11 C T 13: 74,121,800 (GRCm39) R104* probably null Het
Zfp318 T G 17: 46,721,284 (GRCm39) H1176Q probably damaging Het
Zfp335 G A 2: 164,742,242 (GRCm39) H581Y probably damaging Het
Zfp7 T C 15: 76,775,674 (GRCm39) I572T probably damaging Het
Zfp955a T C 17: 33,461,335 (GRCm39) T266A probably benign Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74,880,558 (GRCm39) splice site probably benign
IGL00542:Birc6 APN 17 74,930,766 (GRCm39) splice site probably null
IGL00659:Birc6 APN 17 74,967,648 (GRCm39) missense probably damaging 1.00
IGL00710:Birc6 APN 17 74,916,084 (GRCm39) missense probably benign 0.37
IGL00806:Birc6 APN 17 74,918,524 (GRCm39) missense possibly damaging 0.85
IGL00848:Birc6 APN 17 75,003,388 (GRCm39) nonsense probably null
IGL01071:Birc6 APN 17 74,873,127 (GRCm39) missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74,938,696 (GRCm39) missense probably damaging 1.00
IGL01121:Birc6 APN 17 74,938,033 (GRCm39) missense probably benign 0.08
IGL01132:Birc6 APN 17 74,910,055 (GRCm39) missense probably damaging 1.00
IGL01323:Birc6 APN 17 74,929,920 (GRCm39) missense probably damaging 1.00
IGL01444:Birc6 APN 17 74,938,682 (GRCm39) missense probably damaging 1.00
IGL01511:Birc6 APN 17 74,933,998 (GRCm39) nonsense probably null
IGL01576:Birc6 APN 17 74,984,365 (GRCm39) missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74,955,192 (GRCm39) missense probably benign 0.08
IGL01649:Birc6 APN 17 74,911,541 (GRCm39) missense probably benign 0.03
IGL01657:Birc6 APN 17 74,967,606 (GRCm39) missense probably damaging 1.00
IGL01739:Birc6 APN 17 74,966,216 (GRCm39) missense probably benign
IGL01756:Birc6 APN 17 74,947,203 (GRCm39) missense probably benign 0.00
IGL01807:Birc6 APN 17 74,938,032 (GRCm39) missense probably benign
IGL01885:Birc6 APN 17 74,911,511 (GRCm39) missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74,945,353 (GRCm39) missense probably damaging 1.00
IGL01915:Birc6 APN 17 74,938,715 (GRCm39) missense probably benign 0.34
IGL01998:Birc6 APN 17 74,886,880 (GRCm39) missense probably benign 0.06
IGL02084:Birc6 APN 17 74,915,277 (GRCm39) missense probably benign 0.45
IGL02086:Birc6 APN 17 74,946,822 (GRCm39) missense probably damaging 1.00
IGL02161:Birc6 APN 17 74,855,832 (GRCm39) missense probably damaging 0.99
IGL02195:Birc6 APN 17 75,004,376 (GRCm39) splice site probably benign
IGL02283:Birc6 APN 17 74,906,935 (GRCm39) missense probably benign
IGL02476:Birc6 APN 17 75,003,386 (GRCm39) missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74,959,054 (GRCm39) unclassified probably benign
IGL02547:Birc6 APN 17 74,886,640 (GRCm39) missense probably benign 0.21
IGL02678:Birc6 APN 17 74,956,898 (GRCm39) missense probably damaging 1.00
IGL02713:Birc6 APN 17 74,886,319 (GRCm39) missense probably benign
IGL02851:Birc6 APN 17 74,916,184 (GRCm39) missense probably damaging 1.00
IGL02875:Birc6 APN 17 74,896,713 (GRCm39) missense probably damaging 1.00
IGL02985:Birc6 APN 17 74,947,185 (GRCm39) missense probably benign 0.00
IGL03004:Birc6 APN 17 74,919,180 (GRCm39) missense probably benign 0.10
IGL03053:Birc6 APN 17 74,872,967 (GRCm39) missense probably damaging 1.00
IGL03085:Birc6 APN 17 74,903,945 (GRCm39) missense probably damaging 0.97
IGL03109:Birc6 APN 17 74,886,329 (GRCm39) missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74,905,994 (GRCm39) missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74,966,226 (GRCm39) missense probably benign
IGL03221:Birc6 APN 17 74,934,002 (GRCm39) missense probably benign 0.00
IGL03230:Birc6 APN 17 74,918,065 (GRCm39) missense probably damaging 1.00
IGL03294:Birc6 APN 17 74,956,881 (GRCm39) missense probably benign 0.02
IGL03399:Birc6 APN 17 74,901,368 (GRCm39) missense probably benign 0.01
Badlands UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
Big_sky UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
bitterroot UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
Black_hills UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
bottomlands UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
Chai UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
Dakota UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
Sempervirens UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
E0370:Birc6 UTSW 17 74,984,352 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
PIT4494001:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R0081:Birc6 UTSW 17 74,950,436 (GRCm39) missense probably benign 0.01
R0086:Birc6 UTSW 17 74,900,161 (GRCm39) missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74,945,371 (GRCm39) missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74,930,741 (GRCm39) splice site probably benign
R0129:Birc6 UTSW 17 74,835,755 (GRCm39) missense probably benign 0.05
R0196:Birc6 UTSW 17 74,887,282 (GRCm39) missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74,916,322 (GRCm39) missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74,969,827 (GRCm39) splice site probably benign
R0295:Birc6 UTSW 17 74,920,357 (GRCm39) intron probably benign
R0386:Birc6 UTSW 17 74,906,335 (GRCm39) missense probably damaging 0.99
R0423:Birc6 UTSW 17 75,003,292 (GRCm39) missense probably damaging 1.00
R0449:Birc6 UTSW 17 74,999,290 (GRCm39) missense probably damaging 1.00
R0453:Birc6 UTSW 17 74,956,749 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,969,620 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,959,023 (GRCm39) missense probably benign
R0564:Birc6 UTSW 17 74,932,238 (GRCm39) splice site probably benign
R0575:Birc6 UTSW 17 74,996,232 (GRCm39) missense probably damaging 1.00
R0582:Birc6 UTSW 17 74,950,332 (GRCm39) missense probably damaging 1.00
R0624:Birc6 UTSW 17 74,887,344 (GRCm39) missense probably benign 0.20
R0973:Birc6 UTSW 17 74,872,856 (GRCm39) missense probably damaging 0.99
R1061:Birc6 UTSW 17 74,996,307 (GRCm39) missense probably damaging 1.00
R1378:Birc6 UTSW 17 74,967,450 (GRCm39) missense probably damaging 1.00
R1402:Birc6 UTSW 17 75,004,528 (GRCm39) splice site probably benign
R1436:Birc6 UTSW 17 74,959,700 (GRCm39) missense probably damaging 1.00
R1456:Birc6 UTSW 17 74,916,285 (GRCm39) missense probably benign 0.35
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1474:Birc6 UTSW 17 74,886,673 (GRCm39) missense probably damaging 0.98
R1479:Birc6 UTSW 17 74,941,848 (GRCm39) missense probably damaging 1.00
R1486:Birc6 UTSW 17 74,946,815 (GRCm39) missense probably damaging 1.00
R1499:Birc6 UTSW 17 74,919,314 (GRCm39) missense probably damaging 1.00
R1515:Birc6 UTSW 17 74,835,631 (GRCm39) nonsense probably null
R1549:Birc6 UTSW 17 74,969,737 (GRCm39) missense probably damaging 1.00
R1559:Birc6 UTSW 17 74,999,232 (GRCm39) missense probably damaging 1.00
R1573:Birc6 UTSW 17 74,967,685 (GRCm39) splice site probably benign
R1615:Birc6 UTSW 17 74,916,404 (GRCm39) splice site probably null
R1621:Birc6 UTSW 17 74,977,245 (GRCm39) missense probably benign
R1680:Birc6 UTSW 17 74,855,741 (GRCm39) missense probably benign 0.01
R1743:Birc6 UTSW 17 74,886,751 (GRCm39) missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74,947,008 (GRCm39) missense probably damaging 1.00
R1775:Birc6 UTSW 17 74,919,281 (GRCm39) missense probably damaging 1.00
R1818:Birc6 UTSW 17 74,956,844 (GRCm39) missense probably damaging 1.00
R1836:Birc6 UTSW 17 74,921,385 (GRCm39) missense probably benign 0.41
R1931:Birc6 UTSW 17 74,872,977 (GRCm39) missense probably damaging 0.99
R1939:Birc6 UTSW 17 74,977,332 (GRCm39) missense probably damaging 1.00
R1964:Birc6 UTSW 17 74,941,880 (GRCm39) missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74,905,057 (GRCm39) missense probably benign 0.01
R2000:Birc6 UTSW 17 74,911,614 (GRCm39) missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
R2090:Birc6 UTSW 17 74,969,791 (GRCm39) missense probably benign
R2130:Birc6 UTSW 17 74,966,149 (GRCm39) splice site probably benign
R2144:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74,942,790 (GRCm39) missense probably benign 0.02
R2180:Birc6 UTSW 17 74,919,146 (GRCm39) missense probably benign 0.03
R2271:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2272:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2416:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2421:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2422:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2513:Birc6 UTSW 17 74,954,724 (GRCm39) missense probably damaging 0.97
R2912:Birc6 UTSW 17 74,999,201 (GRCm39) missense probably damaging 1.00
R3024:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3772:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3829:Birc6 UTSW 17 74,962,173 (GRCm39) missense probably damaging 1.00
R3913:Birc6 UTSW 17 74,880,608 (GRCm39) nonsense probably null
R3915:Birc6 UTSW 17 74,886,603 (GRCm39) missense probably benign 0.12
R3921:Birc6 UTSW 17 74,934,014 (GRCm39) missense probably damaging 0.98
R3928:Birc6 UTSW 17 74,945,404 (GRCm39) missense probably damaging 1.00
R3928:Birc6 UTSW 17 74,918,170 (GRCm39) missense possibly damaging 0.91
R4111:Birc6 UTSW 17 74,873,010 (GRCm39) missense probably damaging 1.00
R4155:Birc6 UTSW 17 74,903,934 (GRCm39) missense probably benign 0.00
R4163:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R4226:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4227:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4358:Birc6 UTSW 17 74,926,663 (GRCm39) splice site probably null
R4524:Birc6 UTSW 17 74,948,772 (GRCm39) missense probably damaging 1.00
R4605:Birc6 UTSW 17 74,946,929 (GRCm39) missense probably damaging 1.00
R4619:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4620:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4762:Birc6 UTSW 17 74,936,484 (GRCm39) missense probably damaging 1.00
R4814:Birc6 UTSW 17 74,956,667 (GRCm39) missense probably damaging 1.00
R4849:Birc6 UTSW 17 74,954,383 (GRCm39) missense probably damaging 0.99
R4869:Birc6 UTSW 17 74,893,007 (GRCm39) missense probably benign 0.05
R4912:Birc6 UTSW 17 74,872,900 (GRCm39) missense probably damaging 1.00
R4921:Birc6 UTSW 17 74,957,094 (GRCm39) missense probably damaging 1.00
R4942:Birc6 UTSW 17 74,930,045 (GRCm39) missense probably damaging 1.00
R4954:Birc6 UTSW 17 74,919,026 (GRCm39) missense probably damaging 1.00
R4992:Birc6 UTSW 17 74,996,251 (GRCm39) missense probably benign 0.44
R4994:Birc6 UTSW 17 74,901,319 (GRCm39) intron probably benign
R5018:Birc6 UTSW 17 74,947,054 (GRCm39) missense probably damaging 1.00
R5022:Birc6 UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
R5054:Birc6 UTSW 17 74,962,320 (GRCm39) missense probably damaging 1.00
R5068:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5069:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5070:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5196:Birc6 UTSW 17 74,913,136 (GRCm39) splice site probably benign
R5209:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5212:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5216:Birc6 UTSW 17 74,920,465 (GRCm39) missense probably damaging 1.00
R5279:Birc6 UTSW 17 74,957,042 (GRCm39) missense probably damaging 0.98
R5286:Birc6 UTSW 17 74,977,242 (GRCm39) missense probably damaging 1.00
R5399:Birc6 UTSW 17 74,911,573 (GRCm39) missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74,969,685 (GRCm39) missense probably damaging 1.00
R5482:Birc6 UTSW 17 74,948,777 (GRCm39) missense possibly damaging 0.86
R5492:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5504:Birc6 UTSW 17 74,962,208 (GRCm39) missense probably damaging 1.00
R5519:Birc6 UTSW 17 74,887,173 (GRCm39) missense probably benign
R5544:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5608:Birc6 UTSW 17 74,920,539 (GRCm39) missense probably damaging 0.99
R5623:Birc6 UTSW 17 74,835,651 (GRCm39) missense probably damaging 0.99
R5701:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R5707:Birc6 UTSW 17 75,003,399 (GRCm39) missense probably damaging 1.00
R5715:Birc6 UTSW 17 74,938,615 (GRCm39) missense probably damaging 1.00
R5734:Birc6 UTSW 17 74,925,419 (GRCm39) splice site probably benign
R5792:Birc6 UTSW 17 74,938,048 (GRCm39) missense probably benign 0.05
R5809:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5810:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5813:Birc6 UTSW 17 74,953,497 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,232 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,233 (GRCm39) missense probably damaging 0.98
R5960:Birc6 UTSW 17 74,835,760 (GRCm39) missense probably damaging 0.97
R5961:Birc6 UTSW 17 74,953,596 (GRCm39) missense probably damaging 1.00
R5967:Birc6 UTSW 17 74,967,434 (GRCm39) missense probably damaging 0.99
R5970:Birc6 UTSW 17 74,925,497 (GRCm39) missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
R5982:Birc6 UTSW 17 74,955,153 (GRCm39) missense probably benign
R6023:Birc6 UTSW 17 74,961,372 (GRCm39) missense probably benign 0.24
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6243:Birc6 UTSW 17 74,916,382 (GRCm39) missense probably damaging 0.96
R6294:Birc6 UTSW 17 74,996,252 (GRCm39) missense probably benign 0.00
R6327:Birc6 UTSW 17 74,969,774 (GRCm39) missense probably damaging 1.00
R6501:Birc6 UTSW 17 74,886,276 (GRCm39) missense probably damaging 1.00
R6810:Birc6 UTSW 17 74,919,215 (GRCm39) missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
R6822:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
R6835:Birc6 UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
R6945:Birc6 UTSW 17 74,886,526 (GRCm39) missense probably benign 0.04
R6957:Birc6 UTSW 17 74,886,486 (GRCm39) missense probably benign
R6989:Birc6 UTSW 17 74,937,984 (GRCm39) missense probably benign 0.18
R6991:Birc6 UTSW 17 74,869,090 (GRCm39) missense probably damaging 1.00
R7019:Birc6 UTSW 17 74,916,340 (GRCm39) missense probably benign 0.01
R7092:Birc6 UTSW 17 74,953,740 (GRCm39) missense probably damaging 1.00
R7158:Birc6 UTSW 17 74,901,371 (GRCm39) missense probably benign 0.25
R7204:Birc6 UTSW 17 74,947,103 (GRCm39) missense probably damaging 1.00
R7267:Birc6 UTSW 17 74,892,980 (GRCm39) missense probably benign 0.00
R7316:Birc6 UTSW 17 74,911,489 (GRCm39) missense probably damaging 0.99
R7341:Birc6 UTSW 17 74,919,069 (GRCm39) missense probably damaging 1.00
R7404:Birc6 UTSW 17 74,946,789 (GRCm39) missense possibly damaging 0.73
R7449:Birc6 UTSW 17 75,009,336 (GRCm39) missense probably benign
R7498:Birc6 UTSW 17 74,967,465 (GRCm39) missense probably damaging 1.00
R7539:Birc6 UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
R7569:Birc6 UTSW 17 74,905,077 (GRCm39) missense possibly damaging 0.71
R7574:Birc6 UTSW 17 74,886,879 (GRCm39) missense probably benign
R7611:Birc6 UTSW 17 74,969,713 (GRCm39) missense probably damaging 0.98
R7653:Birc6 UTSW 17 74,954,729 (GRCm39) missense possibly damaging 0.91
R7716:Birc6 UTSW 17 74,869,056 (GRCm39) missense probably damaging 0.99
R7728:Birc6 UTSW 17 74,929,100 (GRCm39) missense probably benign 0.01
R7810:Birc6 UTSW 17 74,855,815 (GRCm39) missense probably damaging 0.98
R7828:Birc6 UTSW 17 74,886,501 (GRCm39) missense probably damaging 0.97
R7881:Birc6 UTSW 17 74,948,666 (GRCm39) missense probably damaging 0.99
R7896:Birc6 UTSW 17 74,929,077 (GRCm39) missense probably damaging 0.99
R7950:Birc6 UTSW 17 74,900,095 (GRCm39) missense probably damaging 1.00
R7988:Birc6 UTSW 17 74,906,368 (GRCm39) splice site probably null
R8073:Birc6 UTSW 17 74,910,080 (GRCm39) missense probably damaging 1.00
R8128:Birc6 UTSW 17 74,916,253 (GRCm39) missense probably damaging 1.00
R8167:Birc6 UTSW 17 74,950,389 (GRCm39) missense probably damaging 1.00
R8236:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8237:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8255:Birc6 UTSW 17 74,969,775 (GRCm39) missense probably damaging 0.99
R8259:Birc6 UTSW 17 74,905,073 (GRCm39) missense probably benign 0.01
R8297:Birc6 UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
R8376:Birc6 UTSW 17 74,896,635 (GRCm39) missense probably benign 0.18
R8413:Birc6 UTSW 17 74,853,388 (GRCm39) missense possibly damaging 0.54
R8503:Birc6 UTSW 17 74,999,239 (GRCm39) missense probably damaging 1.00
R8504:Birc6 UTSW 17 74,959,000 (GRCm39) missense probably damaging 0.98
R8543:Birc6 UTSW 17 74,872,860 (GRCm39) missense probably damaging 1.00
R8550:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8551:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8556:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8683:Birc6 UTSW 17 74,916,114 (GRCm39) missense possibly damaging 0.74
R8751:Birc6 UTSW 17 74,955,135 (GRCm39) missense probably damaging 0.98
R8803:Birc6 UTSW 17 74,959,033 (GRCm39) missense probably damaging 0.99
R8806:Birc6 UTSW 17 74,949,311 (GRCm39) missense probably damaging 1.00
R8825:Birc6 UTSW 17 74,920,500 (GRCm39) missense probably damaging 0.99
R8888:Birc6 UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
R8972:Birc6 UTSW 17 75,009,313 (GRCm39) missense probably benign 0.05
R9069:Birc6 UTSW 17 74,868,260 (GRCm39) splice site probably benign
R9111:Birc6 UTSW 17 74,966,340 (GRCm39) missense probably damaging 0.99
R9130:Birc6 UTSW 17 74,919,146 (GRCm39) missense
R9354:Birc6 UTSW 17 74,921,401 (GRCm39) missense probably benign
R9432:Birc6 UTSW 17 74,966,216 (GRCm39) missense probably benign
R9446:Birc6 UTSW 17 74,925,491 (GRCm39) missense probably damaging 1.00
R9485:Birc6 UTSW 17 74,945,398 (GRCm39) missense probably damaging 1.00
R9499:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9551:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9552:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9585:Birc6 UTSW 17 74,916,265 (GRCm39) missense probably damaging 1.00
R9647:Birc6 UTSW 17 74,999,305 (GRCm39) missense probably damaging 1.00
R9648:Birc6 UTSW 17 74,938,696 (GRCm39) missense probably damaging 1.00
R9667:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R9696:Birc6 UTSW 17 74,947,292 (GRCm39) missense probably damaging 0.99
RF016:Birc6 UTSW 17 74,996,319 (GRCm39) missense probably damaging 1.00
Z1088:Birc6 UTSW 17 74,918,537 (GRCm39) missense probably damaging 0.99
Z1177:Birc6 UTSW 17 74,954,275 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTGTAGGTCAGCCACTACCAGC -3'
(R):5'- CGCTGTGTAACTCCATGGAG -3'

Sequencing Primer
(F):5'- GCAGAAATGACACTTGCCCAG -3'
(R):5'- AGTGTTATAGCTGGTCCTGTCTCC -3'
Posted On 2022-04-18