Mutagenetix > Incidental Mutations

Incidental Mutation 'R0744:Fbn1'

70820

Institutional Source

Beutler Lab

Gene Symbol

Fbn1

Ensembl Gene

ENSMUSG00000027204

Gene Name

fibrillin 1

Synonyms

Fib-1

MMRRC Submission

038925-MU

Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene?

Probably essential (E-score: 0.881) question?

Stock #

R0744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125300594-125507993 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 125314814 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]

Predicted Effect

probably benign
Transcript: ENSMUST00000028633

SMART Domains

Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	193	235	6.9e-17	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	343	388	2.3e-17	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	670	712	1.4e-17	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	862	902	2.1e-14	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	967	1009	3.9e-17	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1549	1590	3.5e-18	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1706	1749	9.7e-18	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2070	2112	3.7e-17	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2348	2391	8.5e-18	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103234

SMART Domains

Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
EGF	118	146	8.52e0	SMART
EGF	149	178	5.4e-2	SMART
Pfam:TB	194	232	3.5e-10	PFAM
EGF_CA	246	287	3.56e-11	SMART
EGF_CA	288	329	9.39e-11	SMART
Pfam:TB	344	388	6.8e-15	PFAM
low complexity region	394	445	N/A	INTRINSIC
EGF	454	491	8.57e-5	SMART
EGF_CA	492	531	9.39e-11	SMART
EGF_CA	532	573	2.38e-12	SMART
EGF_CA	574	614	5.48e-12	SMART
EGF_CA	615	655	5.39e-11	SMART
Pfam:TB	671	712	8.3e-16	PFAM
EGF_CA	725	766	1.53e-10	SMART
EGF_CA	767	808	2.42e-13	SMART
EGF_CA	809	848	2.44e-9	SMART
Pfam:TB	863	898	3.1e-8	PFAM
EGF_CA	912	953	3.32e-11	SMART
Pfam:TB	968	1009	1.5e-15	PFAM
EGF_CA	1030	1071	5.11e-12	SMART
EGF_CA	1072	1114	5.39e-11	SMART
EGF_CA	1115	1156	1.55e-11	SMART
EGF_CA	1157	1198	5.48e-12	SMART
EGF_CA	1199	1239	5.61e-9	SMART
EGF_CA	1240	1281	1.22e-9	SMART
EGF_CA	1282	1323	2.62e-9	SMART
EGF_CA	1324	1364	3.27e-10	SMART
EGF_CA	1365	1405	4.7e-11	SMART
EGF_CA	1406	1447	1.91e-11	SMART
EGF_CA	1448	1488	1.98e-9	SMART
EGF_CA	1489	1529	2.13e-9	SMART
Pfam:TB	1550	1590	5.3e-17	PFAM
EGF_CA	1608	1649	2.19e-11	SMART
EGF_CA	1650	1690	3.97e-9	SMART
Pfam:TB	1707	1749	1.6e-16	PFAM
EGF_CA	1768	1809	5.11e-12	SMART
EGF_CA	1810	1850	1.1e-11	SMART
EGF_CA	1851	1892	5.69e-10	SMART
EGF_CA	1893	1931	6.1e-10	SMART
EGF_CA	1932	1974	2.11e-13	SMART
EGF_CA	1975	2014	7.23e-12	SMART
EGF_CA	2015	2056	3.15e-12	SMART
Pfam:TB	2071	2112	1.9e-15	PFAM
EGF_CA	2129	2167	1.24e-10	SMART
EGF_CA	2168	2207	3.81e-11	SMART
EGF_CA	2208	2248	3.81e-11	SMART
EGF	2252	2292	5.24e0	SMART
EGF_CA	2293	2334	9.91e-10	SMART
Pfam:TB	2349	2391	5.8e-15	PFAM
EGF_CA	2404	2445	1.26e-11	SMART
EGF_CA	2446	2486	1.06e-9	SMART
EGF_CA	2487	2525	3.1e-11	SMART
EGF_CA	2526	2568	1.48e-8	SMART
EGF_CA	2569	2608	1.14e-9	SMART
EGF_CA	2609	2649	3.97e-9	SMART
EGF_CA	2650	2689	1.98e-9	SMART
low complexity region	2691	2698	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

98% (91/93)

MGI Phenotype

Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aebp2	T	G	6: 140,642,364		probably null	Het
AI987944	T	C	7: 41,376,859	Y6C	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Baiap2l1	T	A	5: 144,266,641	D479V	probably benign	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dzip3	A	G	16: 48,959,675	Y301H	probably damaging	Het
Ephb4	T	A	5: 137,365,667	N600K	probably damaging	Het
Erich6	T	A	3: 58,636,122		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Galnt17	T	A	5: 131,150,916	D131V	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Gm6619	T	A	6: 131,490,334	L54Q	probably damaging	Het
Herc2	T	C	7: 56,206,036		probably benign	Het
Hic1	T	A	11: 75,165,801	Q754L	possibly damaging	Het
Hnf4g	A	T	3: 3,651,629	D286V	possibly damaging	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc58	A	G	16: 37,878,573		probably benign	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mark1	T	A	1: 184,921,608	I166F	probably damaging	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mast4	C	G	13: 102,737,387	Q1632H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mgst3	A	G	1: 167,373,805	Y104H	probably damaging	Het
Mlxipl	C	T	5: 135,132,475	T416I	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Muc1	C	A	3: 89,230,328	P159Q	possibly damaging	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Myt1	TGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGG	2: 181,797,505		probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr329-ps	T	A	11: 58,543,162	M105L	possibly damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Pzp	A	G	6: 128,516,195		probably benign	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapgef3	G	A	15: 97,761,585		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rgs11	T	A	17: 26,203,318	M29K	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Slc6a13	T	G	6: 121,302,867	W67G	probably damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Supt20	T	A	3: 54,714,701	Y409N	probably damaging	Het
Synrg	C	T	11: 84,024,305	Q1046*	probably null	Het
Tab2	T	C	10: 7,907,581		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm6	T	C	2: 130,151,761	V640A	probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Tomm34	T	C	2: 164,070,976	N22D	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Trim62	A	G	4: 128,884,215	S16G	probably damaging	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Ush2a	C	T	1: 188,814,406		probably benign	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zbed5	T	A	5: 129,902,272	V354E	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Fbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Fbn1	APN	2	125324947	missense	probably damaging	1.00
IGL00159:Fbn1	APN	2	125397873	missense	probably benign	0.14
IGL00500:Fbn1	APN	2	125317516	missense	probably damaging	0.99
IGL00558:Fbn1	APN	2	125329128	splice site	probably benign
IGL00645:Fbn1	APN	2	125317103	splice site	probably benign
IGL00863:Fbn1	APN	2	125403219	missense	possibly damaging	0.84
IGL00926:Fbn1	APN	2	125319042	missense	possibly damaging	0.84
IGL00935:Fbn1	APN	2	125377910	nonsense	probably null
IGL00950:Fbn1	APN	2	125358823	missense	probably damaging	1.00
IGL01090:Fbn1	APN	2	125394776	splice site	probably benign
IGL01106:Fbn1	APN	2	125351706	missense	possibly damaging	0.55
IGL01486:Fbn1	APN	2	125389978	missense	probably benign	0.03
IGL01519:Fbn1	APN	2	125317019	missense	probably benign	0.07
IGL01585:Fbn1	APN	2	125360110	missense	probably damaging	0.98
IGL01730:Fbn1	APN	2	125312974	splice site	probably benign
IGL01793:Fbn1	APN	2	125387293	missense	possibly damaging	0.67
IGL01803:Fbn1	APN	2	125350287	missense	probably damaging	1.00
IGL01803:Fbn1	APN	2	125301725	missense	probably benign
IGL01916:Fbn1	APN	2	125315446	missense	possibly damaging	0.55
IGL02035:Fbn1	APN	2	125335362	splice site	probably null
IGL02097:Fbn1	APN	2	125363969	missense	probably damaging	1.00
IGL02233:Fbn1	APN	2	125321610	splice site	probably benign
IGL02512:Fbn1	APN	2	125338460	missense	probably damaging	1.00
IGL02552:Fbn1	APN	2	125412713	missense	possibly damaging	0.86
IGL02657:Fbn1	APN	2	125352025	missense	possibly damaging	0.86
IGL02718:Fbn1	APN	2	125369886	missense	probably damaging	1.00
IGL02863:Fbn1	APN	2	125303256	missense	possibly damaging	0.80
IGL02974:Fbn1	APN	2	125346330	missense	probably null	0.99
IGL03058:Fbn1	APN	2	125403200	missense	probably benign	0.03
IGL03172:Fbn1	APN	2	125320968	missense	possibly damaging	0.92
IGL03288:Fbn1	APN	2	125303183	missense	probably benign	0.13
Carinatum	UTSW	2	125342830	missense	possibly damaging	0.70
lincoln	UTSW	2	125403170	missense	possibly damaging	0.50
reaper	UTSW	2	125315404	missense	probably damaging	0.98
Scythe	UTSW	2	125403228	missense	possibly damaging	0.84
string_bean	UTSW	2	125379134	splice site	probably null
wirey	UTSW	2	125309495	missense	probably benign
3-1:Fbn1	UTSW	2	125394605	splice site	probably benign
P0012:Fbn1	UTSW	2	125369321	splice site	probably benign
PIT4403001:Fbn1	UTSW	2	125342911	missense	probably damaging	1.00
PIT4466001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4472001:Fbn1	UTSW	2	125306501	missense	possibly damaging	0.90
PIT4651001:Fbn1	UTSW	2	125363989	critical splice acceptor site	probably null
R0226:Fbn1	UTSW	2	125320910	missense	possibly damaging	0.86
R0310:Fbn1	UTSW	2	125363644	missense	probably damaging	1.00
R0362:Fbn1	UTSW	2	125309777	missense	probably damaging	0.99
R0374:Fbn1	UTSW	2	125321676	missense	possibly damaging	0.86
R0433:Fbn1	UTSW	2	125348215	missense	possibly damaging	0.95
R0441:Fbn1	UTSW	2	125309755	critical splice donor site	probably null
R0501:Fbn1	UTSW	2	125301749	missense	probably benign	0.23
R0510:Fbn1	UTSW	2	125342925	splice site	probably benign
R0573:Fbn1	UTSW	2	125389249	missense	probably damaging	0.99
R0622:Fbn1	UTSW	2	125379024	missense	possibly damaging	0.88
R0630:Fbn1	UTSW	2	125394770	missense	possibly damaging	0.48
R0724:Fbn1	UTSW	2	125352064	missense	probably benign	0.14
R0739:Fbn1	UTSW	2	125367630	missense	probably benign	0.18
R0811:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0812:Fbn1	UTSW	2	125403170	missense	possibly damaging	0.50
R0862:Fbn1	UTSW	2	125342891	nonsense	probably null
R0864:Fbn1	UTSW	2	125342891	nonsense	probably null
R1061:Fbn1	UTSW	2	125345963	missense	probably benign	0.01
R1126:Fbn1	UTSW	2	125321192	splice site	probably null
R1172:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1175:Fbn1	UTSW	2	125394687	missense	probably benign	0.13
R1183:Fbn1	UTSW	2	125321617	missense	probably benign	0.07
R1218:Fbn1	UTSW	2	125412749	missense	possibly damaging	0.71
R1241:Fbn1	UTSW	2	125372527	splice site	probably benign
R1248:Fbn1	UTSW	2	125301609	missense	probably benign	0.01
R1345:Fbn1	UTSW	2	125314671	missense	probably damaging	1.00
R1374:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1458:Fbn1	UTSW	2	125301929	missense	probably benign	0.01
R1474:Fbn1	UTSW	2	125361265	missense	possibly damaging	0.72
R1496:Fbn1	UTSW	2	125309495	missense	probably benign
R1502:Fbn1	UTSW	2	125363706	nonsense	probably null
R1511:Fbn1	UTSW	2	125306285	missense	probably benign	0.00
R1588:Fbn1	UTSW	2	125319114	missense	probably benign	0.19
R1626:Fbn1	UTSW	2	125341279	missense	probably damaging	1.00
R1676:Fbn1	UTSW	2	125309781	missense	probably damaging	1.00
R1712:Fbn1	UTSW	2	125346434	missense	probably damaging	0.99
R1772:Fbn1	UTSW	2	125403228	missense	possibly damaging	0.84
R1776:Fbn1	UTSW	2	125321734	missense	possibly damaging	0.71
R1869:Fbn1	UTSW	2	125352027	missense	probably benign	0.00
R1894:Fbn1	UTSW	2	125394621	missense	probably damaging	0.96
R1925:Fbn1	UTSW	2	125363629	missense	probably damaging	1.00
R1957:Fbn1	UTSW	2	125367654	missense	possibly damaging	0.93
R1995:Fbn1	UTSW	2	125350373	critical splice acceptor site	probably null
R2140:Fbn1	UTSW	2	125343810	missense	probably damaging	1.00
R2142:Fbn1	UTSW	2	125412708	missense	possibly damaging	0.93
R2268:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R3409:Fbn1	UTSW	2	125412665	missense	possibly damaging	0.92
R3418:Fbn1	UTSW	2	125320926	missense	possibly damaging	0.55
R3508:Fbn1	UTSW	2	125306327	missense	probably benign	0.19
R3778:Fbn1	UTSW	2	125317086	missense	probably damaging	1.00
R3800:Fbn1	UTSW	2	125345974	missense	possibly damaging	0.63
R4001:Fbn1	UTSW	2	125477495	critical splice donor site	probably null
R4169:Fbn1	UTSW	2	125363952	missense	possibly damaging	0.86
R4398:Fbn1	UTSW	2	125397781	missense	probably benign	0.32
R4482:Fbn1	UTSW	2	125363610	critical splice donor site	probably null
R4559:Fbn1	UTSW	2	125351714	missense	possibly damaging	0.65
R4608:Fbn1	UTSW	2	125306500	missense	probably benign	0.05
R4634:Fbn1	UTSW	2	125344061	missense	probably damaging	1.00
R4706:Fbn1	UTSW	2	125370149	missense	probably benign	0.21
R4712:Fbn1	UTSW	2	125341316	missense	probably benign	0.12
R4783:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4784:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4785:Fbn1	UTSW	2	125324919	missense	probably damaging	1.00
R4793:Fbn1	UTSW	2	125321235	nonsense	probably null
R4838:Fbn1	UTSW	2	125372399	missense	probably benign	0.01
R4864:Fbn1	UTSW	2	125372397	missense	possibly damaging	0.92
R4887:Fbn1	UTSW	2	125309774	missense	probably damaging	1.00
R4942:Fbn1	UTSW	2	125383616	missense	possibly damaging	0.88
R4952:Fbn1	UTSW	2	125317534	missense	probably damaging	1.00
R5030:Fbn1	UTSW	2	125412704	missense	possibly damaging	0.51
R5044:Fbn1	UTSW	2	125329102	missense	probably damaging	0.97
R5057:Fbn1	UTSW	2	125466695	missense	probably benign	0.33
R5115:Fbn1	UTSW	2	125332383	missense	probably damaging	1.00
R5399:Fbn1	UTSW	2	125332333	missense	possibly damaging	0.69
R5498:Fbn1	UTSW	2	125360176	missense	probably damaging	1.00
R5526:Fbn1	UTSW	2	125365639	missense	possibly damaging	0.83
R5529:Fbn1	UTSW	2	125373950	missense	probably benign	0.01
R5602:Fbn1	UTSW	2	125321741	missense	possibly damaging	0.49
R5760:Fbn1	UTSW	2	125361247	missense	probably damaging	1.00
R5837:Fbn1	UTSW	2	125379134	splice site	probably null
R5955:Fbn1	UTSW	2	125358882	missense	probably damaging	1.00
R5980:Fbn1	UTSW	2	125315404	missense	probably damaging	0.98
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6039:Fbn1	UTSW	2	125363880	missense	probably damaging	1.00
R6058:Fbn1	UTSW	2	125466612	missense	possibly damaging	0.73
R6089:Fbn1	UTSW	2	125321225	missense	possibly damaging	0.55
R6136:Fbn1	UTSW	2	125403132	missense	possibly damaging	0.63
R6161:Fbn1	UTSW	2	125369801	nonsense	probably null
R6162:Fbn1	UTSW	2	125360227	missense	probably damaging	1.00
R6165:Fbn1	UTSW	2	125332363	missense	probably damaging	0.99
R6169:Fbn1	UTSW	2	125335489	critical splice acceptor site	probably null
R6221:Fbn1	UTSW	2	125320921	missense	probably benign	0.07
R6223:Fbn1	UTSW	2	125412671	missense	possibly damaging	0.86
R6225:Fbn1	UTSW	2	125330543	missense	probably damaging	1.00
R6238:Fbn1	UTSW	2	125324945	missense	probably damaging	0.98
R6329:Fbn1	UTSW	2	125308473	missense	possibly damaging	0.70
R6401:Fbn1	UTSW	2	125346450	missense	probably damaging	0.98
R6480:Fbn1	UTSW	2	125335418	missense	probably benign	0.05
R6513:Fbn1	UTSW	2	125383671	missense	probably damaging	1.00
R6530:Fbn1	UTSW	2	125389270	missense	probably damaging	0.99
R6595:Fbn1	UTSW	2	125342830	missense	possibly damaging	0.70
R6781:Fbn1	UTSW	2	125317038	missense	probably damaging	1.00
R6849:Fbn1	UTSW	2	125321691	missense	possibly damaging	0.82
R6860:Fbn1	UTSW	2	125328158	missense	probably damaging	1.00
R6960:Fbn1	UTSW	2	125382060	missense	probably benign	0.16
R7134:Fbn1	UTSW	2	125382049	missense	probably benign	0.03
R7241:Fbn1	UTSW	2	125306495	missense	possibly damaging	0.86
R7295:Fbn1	UTSW	2	125335487	missense	probably damaging	1.00
R7312:Fbn1	UTSW	2	125466674	missense	possibly damaging	0.53
R7322:Fbn1	UTSW	2	125479195	missense	possibly damaging	0.92
R7349:Fbn1	UTSW	2	125315401	missense	possibly damaging	0.84
R7365:Fbn1	UTSW	2	125352049	missense	probably damaging	0.97
R7392:Fbn1	UTSW	2	125343924	missense	probably damaging	1.00
R7442:Fbn1	UTSW	2	125403212	missense	possibly damaging	0.45
R7452:Fbn1	UTSW	2	125505455	missense	possibly damaging	0.53
R7453:Fbn1	UTSW	2	125320959	missense	possibly damaging	0.93
R7457:Fbn1	UTSW	2	125351747	missense	possibly damaging	0.90
R7458:Fbn1	UTSW	2	125319116	missense	probably benign	0.14
R7549:Fbn1	UTSW	2	125344027	missense	probably damaging	0.99
R7570:Fbn1	UTSW	2	125397852	missense	probably benign	0.29
R7666:Fbn1	UTSW	2	125306471	missense	probably damaging	1.00
R7723:Fbn1	UTSW	2	125382034	nonsense	probably null
R7745:Fbn1	UTSW	2	125303195	missense	probably benign	0.06
R7780:Fbn1	UTSW	2	125301758	missense	probably benign	0.15
X0019:Fbn1	UTSW	2	125383643	missense	possibly damaging	0.82
X0020:Fbn1	UTSW	2	125369340	missense	probably damaging	1.00
X0028:Fbn1	UTSW	2	125342798	critical splice donor site	probably null
X0067:Fbn1	UTSW	2	125369914	missense	possibly damaging	0.95
Z1088:Fbn1	UTSW	2	125350288	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAACAAAGTGAAGTACCTGCTCCG -3'
(R):5'- GCACCAATGCCTTTCTGCCAAC -3'

Sequencing Primer
(F):5'- GAAGTACCTGCTCCGTTGGTC -3'
(R):5'- GCCAACTCACAGATTTCTTGTC -3'

Posted On

2013-09-30